Search Advanced

AIMS Electronics and Electrical Engineering

2019, Volume 3, Issue 4: 397-414. doi: 10.3934/ElectrEng.2019.4.397
Previous Article Next Article
Review

A critique of the approach to controlling electrostatic risk in semiconductor production and identification of a potential risk from the use of equipotential bonding

  • Microtome, Colorado Springs, CO 80907, USA
  • Received: 27 August 2019 Accepted: 15 November 2019 Published: 26 November 2019

  • Equipotential bonding, whereby objects are connected to a common electrical potential (usually ground) to prevent electrostatic discharges during material handling, has been shown to increase the risk of field-induced reticle damage. It is explained how the presence of an electric field can cause electrostatic damage in a reticle without a discharge event taking place. A comparison is drawn between the damage mechanisms that can take place in reticles and in semiconductor devices. The use of equipotential bonding during the manufacture of electrically sensitive semiconductor and micro-electro-mechanical systems is discussed. It is concluded that while equipotential bonding eliminates the risk of ESD during material handling, it simultaneously creates other risks for the devices being manufactured, which has the potential to introduce latent defects. An alternative methodology for dealing with electrostatic risk in semiconductor manufacturing is proposed, which would eliminate the undesirable enhancement of field-induction effects that is a consequence of using equipotential bonding.

    Citation: Gavin C Rider. A critique of the approach to controlling electrostatic risk in semiconductor production and identification of a potential risk from the use of equipotential bonding[J]. AIMS Electronics and Electrical Engineering, 2019, 3(4): 397-414. doi: 10.3934/ElectrEng.2019.4.397

    Related Papers:

    [1] Jiajia Jiao, Xiao Xiao, Zhiyu Li . dm-GAN: Distributed multi-latent code inversion enhanced GAN for fast and accurate breast X-ray image automatic generation. Mathematical Biosciences and Engineering, 2023, 20(11): 19485-19503. doi: 10.3934/mbe.2023863
    [2] Wangping Xiong, Yimin Zhu, Qingxia Zeng, Jianqiang Du, Kaiqi Wang, Jigen Luo, Ming Yang, Xian Zhou . Dose-effect relationship analysis of TCM based on deep Boltzmann machine and partial least squares. Mathematical Biosciences and Engineering, 2023, 20(8): 14395-14413. doi: 10.3934/mbe.2023644
    [3] Qi Cui, Ruohan Meng, Zhili Zhou, Xingming Sun, Kaiwen Zhu . An anti-forensic scheme on computer graphic images and natural images using generative adversarial networks. Mathematical Biosciences and Engineering, 2019, 16(5): 4923-4935. doi: 10.3934/mbe.2019248
    [4] Enyang He, Yuhang Jiang, Diwei Wei, Yifan Wang, Wenjing Sun, Miao Jia, Bowen Shi, Hualei Cui . The potential effects and mechanism of echinacoside powder in the treatment of Hirschsprung's Disease. Mathematical Biosciences and Engineering, 2023, 20(8): 14222-14240. doi: 10.3934/mbe.2023636
    [5] Arturo Nicola Natali, Chiara Giulia Fontanella, Silvia Todros, Piero G. Pavan, Simone Carmignato, Filippo Zanini, Emanuele Luigi Carniel . Conformation and mechanics of the polymeric cuff of artificial urinary sphincter. Mathematical Biosciences and Engineering, 2020, 17(4): 3894-3908. doi: 10.3934/mbe.2020216
    [6] Marios G. Krokidis, Themis P. Exarchos, Panagiotis Vlamos . Data-driven biomarker analysis using computational omics approaches to assess neurodegenerative disease progression. Mathematical Biosciences and Engineering, 2021, 18(2): 1813-1832. doi: 10.3934/mbe.2021094
    [7] Feng Wang, Xiaochen Feng, Ren Kong, Shan Chang . Generating new protein sequences by using dense network and attention mechanism. Mathematical Biosciences and Engineering, 2023, 20(2): 4178-4197. doi: 10.3934/mbe.2023195
    [8] Binjie Hou, Gang Chen . A new imbalanced data oversampling method based on Bootstrap method and Wasserstein Generative Adversarial Network. Mathematical Biosciences and Engineering, 2024, 21(3): 4309-4327. doi: 10.3934/mbe.2024190
    [9] Jia Yu, Huiling Peng, Guoqiang Wang, Nianfeng Shi . A topical VAEGAN-IHMM approach for automatic story segmentation. Mathematical Biosciences and Engineering, 2024, 21(7): 6608-6630. doi: 10.3934/mbe.2024289
    [10] Chen Yue, Mingquan Ye, Peipei Wang, Daobin Huang, Xiaojie Lu . SRV-GAN: A generative adversarial network for segmenting retinal vessels. Mathematical Biosciences and Engineering, 2022, 19(10): 9948-9965. doi: 10.3934/mbe.2022464
  • Equipotential bonding, whereby objects are connected to a common electrical potential (usually ground) to prevent electrostatic discharges during material handling, has been shown to increase the risk of field-induced reticle damage. It is explained how the presence of an electric field can cause electrostatic damage in a reticle without a discharge event taking place. A comparison is drawn between the damage mechanisms that can take place in reticles and in semiconductor devices. The use of equipotential bonding during the manufacture of electrically sensitive semiconductor and micro-electro-mechanical systems is discussed. It is concluded that while equipotential bonding eliminates the risk of ESD during material handling, it simultaneously creates other risks for the devices being manufactured, which has the potential to introduce latent defects. An alternative methodology for dealing with electrostatic risk in semiconductor manufacturing is proposed, which would eliminate the undesirable enhancement of field-induction effects that is a consequence of using equipotential bonding.


    1.   Introduction

    The Oddi sphincter (SO) is a precision smooth muscle device at the junction of the bile duct, pancreas and duodenum. It forms a temporal transitional compound movement (MMC) under the multiple and complex regulations of nerves, humors and local reflexes, which play important roles in controlling bile and pancreatic fluid discharge and preventing reflux [1]. Sphincter of Oddi Dysfunction (SOD) is a group of diseases caused by abnormal diastolic function of SO. It is clinically divided into two types, biliary type and pancreatic type, and the former is common [2]. SOD often has no evidence of organic change, but it will bring long-lasting and unbearable trouble to patients. In severe cases, it can be secondary to liver damage, abnormal trypsin and even acute pancreatitis, seriously endangering the life and health of patients [3]. Therefore, it is of great significance to explore the pathological mechanism and drug treatment of SOD.

    Shao Yao Gan Cao Tang (SYGC), sourced from Shang Han Za Bing Lun in 210 CE, is made up of 2 traditional Chinese medicines: Paeoniae radix and Glycyrrhizae radix (1:1), which has been used to treat general muscle pain or tremor in skeletal muscles [4]. The Paeoniae Radix can nourish blood and relieve the depressed liver, and Glycyrrhizae Radix can strengthen the spleen and Qi [5]. It is reported that SYGC can reduce abdominal pain and muscular cramps [4] and suppress duodenal peristalsis during endoscopic retrograde cholangiopancreatography (ERCP) [6]. Our clinical study has indicated that SYGC had good curative effects on SOD, relieving abdominal pain symptoms, improving liver function and reducing bile excretion time [7]. However, its chemical profile responsible for the therapeutic effects on SOD is still unclear.

    Recently, network pharmacology and transcriptomics have been widely used to explore the active components and potential mechanisms of traditional Chinese medicine (TCM) [8,9]. In this study, to enable a full assessment of transcriptomics changes in SOD and to increase our understanding of the SYGC mechanism on SOD, ultra-high-performance liquid chromatography coupled with Quadrupole Exactive-Orbitrap high-resolution mass spectrometry (UHPLC-Q Exactive-Orbitrap HR-MS) was first used to identify chemicals of SYGC. Then, transcriptomics and network pharmacology were applied to uncover the mechanism of SYGC in the treatment of SOD. Finally, the binding affinities between the active compounds and the key targets were determined via molecular docking. Figure 1 shows the flowchart of the study design. This study provides a basis for the clinical application of SYGC in the treatment of SOD.

    Figure 1.  Flowchart of the study design.
    DownLoad: Full-Size Img PowerPoint

    2.   Materials and methods

    2.1.   Ultrahigh-performance liquid chromatography quadrupole-Orbitrap high-resolution mass spectrometry (UHPLC-Q-Orbitrap-HR-MS) analysis and identification of target genes of SYGC

    The ingredients of SYGC samples were measured by UHPLC-Q-Exactive Orbitrap analysis [10] which was performed by an UHPLC system (UltiMate 3000 RS, Thermo Fisher Scientific, USA) coupled with a Q Exactive Orbitrap (QE, Thermo Fisher Scientific, USA) equipped with an electrospray ionization source (ESI). The protonated molecular weights of all identified compounds were calculated within an error of 10 ppm. Following careful comparisons with the retention times and MS/MS spectra of the reference standards, reference literature, Chemical Book and self-built databases, a total of 111 chemicals were identified or tentatively characterized from SYGC. Then, active compounds were screened based on the parameters including Lipinski's "rule of five, " Ghose #violations and GI absorption, which was performed by a SwissADME (http://www.swissadme.ch/) [11]. The target information of each component of SYGC was obtained from HERB (http://herb.ac.cn/) [12], SwisstargetPrediction (http://swisstargetprediction.ch/) [13] and BATMAN-TCM (http://bionet.ncpsb.org.cn/batman-tcm/index.php/Home/Index/index) [14].

    2.2.   Establishment of SOD model

    The animal experiments were performed by the experimental animal welfare ethics review committee of the Shanghai University of TCM. Forty guinea pigs were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China; qualified production number P2020-052). The guinea pigs were fed under a 12 h cycle of light/dark in IVC conditions and had free access to food and water. The guinea pigs were divided into four groups: control group (N), SOD group (M), SYGC gavage treatment group (G), IRE1 inhibit treatment group (IR) as a positive control group (n = 10/group). The M, G and IR groups were injected intravenously with morphine injection at 0.6 mg/kg body weight, and the normal group was injected intravenously with equal volume of normal saline three times a week for a total of 4 weeks. G group was given orally at 12.5 g/kg per day. The IR group was administered by injection of 30 mg/kg twice a week. After the last administration, all animals were fasted for 12 hours, and the abdominal cavity was opened after anesthesia. After the duodenum was dissected, the white papillary protrusion and the texture of the Oddi sphincter tissue were isolated for follow-up experiments. Blood samples were collected for measurement of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities.

    2.3.   Histological staining

    Oddi sphincter tissue samples were fixed in 10% neutral formalin for 48 hours, then dehydrated by conventional gradient, embedded in paraffin, sliced, baked at 60 ℃ for 40 minutes, stained with hematoxylin-eosin (HE) and sealed. The sections were stained with HE to observe the morphological changes such as inflammatory cell infiltration and sphincter injury of Oddi sphincter.

    2.4.   Total RNA extractions and RNA-Seq analysis

    Total RNA in sphincter tissues from the SOD (n = 3) and control samples (n = 3) were extracted using TRIzol Reagent (TIANGEN, China). The purity, concentration and integrity of the total RNA samples were checked for further analysis, and Samples with RNA integrity number (RIN) ≥ 7 were considered to be of high quality. A transcriptome sequencing using the Illumina sequencing platform (HiSeqTM 2500) was conducted on each total RNA sample by OE Biotech Co., Ltd. (Shanghai, China). The raw data were shown in Supplementary data. The differentially expressed genes (DEGs) were screened with |log2 fold-change (FC)| ≥ 1.0 and q ≤ 0.05, which applied for gene ontology (GO) and KEGG enrichment analysis.

    2.5.   Identification of genes targeted by SYGC in SOD and functional enrichment

    To obtain the intersection targets, the key targets of SYGC and SOD DEGs was plotted by https://www.bioinformatics.com.cn, a free online platform for data analysis and visualization. Metascape platform (https://metascape.org/gp/index.html) [15] was applied to perform Gene ontology (GO) and pathway enrichment analysis (Wiki, Reactome and KEGG pathway) of the above intersection targets.

    2.6.   Construction of a protein-protein interaction network of the intersecting target genes

    The STRING (https://string-db.org/) database was applied to create a protein-protein interaction (PPI) network of intersecting target genes. The Cytoscape 3.9.0 (https://cytoscape.org/) was used to visualize complex relationships between the active chemical components and the target genes. Next, Molecular Complex Detection (MCODE) [16] and ClusterOne analysis [17] were used to find the core targets. MCODE scores ≥ 3 and (node ≥ 3 and P < 0.05) were set as the criteria. The number of nodes ≥ 3 and P < 0.05 were set as the criteria for ClusterOne analysis.

    2.7.   Molecular docking validation

    The Protein Data Bank (PDB, https://www.rcsb.org/) was used to obtain the crystal structures of core targets. The three-dimensional structures of active ingredients were downloaded from PubChem (https://pubchem.ncbi.nlm.nih.gov/). Molecular docking was performed to calculate the binding affinity between active ingredients and core targets by the AutoDock Vina (http://vina.scripps.edu/). The corresponding PDB codes were 4af3, 6hky and 4cik for AURKB, KIF11 and PLG, respectively. We first removed the proteins' water molecules, added polar hydrogen. Then, active pockets were built according to the position of ligand in the PDB complex. The binding energy of ligands in PDB structures was applied for positive control.

    2.8.   Verifying of hub genes by RT-qPCR

    Total RNA was extracted from each sphincter of Oddi tissue using TRIzol (Invitrogen Corporation, CA, USA). cDNA was prepared through cDNA Synthesis SuperMix. Using Gapdh as an internal reference, RT-qPCR was performed to detect the mRNA expression levels of intersecting genes among MCODE genes, ClusterONE genes and genes of significant enrichment pathways. The amplification primers were synthesized by Shanghai Sangon Biological Engineering Technology, as shown in Table 1. The mRNA expression level was normalized to that of Gapdh in the same sample. The relative expression of each target gene was calculated by the 2-ΔΔCt method.

    Table 1.  Primer sequence of RT-qPCR.
    Gene name Forward Reverse
    Serpine1 TGGTGGTGACTACTACGACATCCTG GAATGCTGGTGATGGCGGAGAG
    Mmp9 GTGAAGACGCAGACGGTGGATC TAGAAGCGGTCCTGGCAGAAGTAG
    Plg GTGGCGTTACCTGTCAGAAGTGG CCTGTTGGTCGTTGTCTGGATTCC
    Ccnb1 GTGATGTGGATGCGGAAGATGGAG GGCTCTCATGTTTCCAGTGACCTC
    Cacna2d2 ACTACTCCAATCGCCCCTCT GAGTAGGAGATGGAGCGTGC
    Rad51 TGCGTATGCTCGTGGGTTCAAC AGCGGTGGCACTGTCTACAATAAG
    Prkcb AAACCATCAAGTGCTCCCTTAACCC CCCAAATCTCCACGGACAGTCTTC
    Alox5 TCACCATCGCCATCAACACCAAG AGCACAGTGAGGTATAGGTCAGGTC
    Adora2a GCCTATCGCATCCGTGAGTTCC GTGCCTCCTGCCTTGAAGAGTTC
    Chrnb4 GCCGATGGAACCTATGAAGTGTCTG GGGAAGTGCCTGACCTCAATCTTG
    Aurkb AGAAAGTGGATCTGTGGTGCATTGG CGCCTGTAAGTCTCGTTGTGTGAG
    Top2a ATGTTGAATGGCACCGAGAAGACC CGGCTCTCTCCACCTCTGACAG
    Tyms TGCCCTTCAACATTGCCAGCTAC GTGTGCGTCTCCCAGTGTATGC
    Kif11 CGGAAAGCTAACGCCCACTCAG TCTTATCAGCCAGTCCTCCAGTTCG
    Kcnq1 GACGATTGCCTCCTGCTTCTCTG GCCTCTGCTTCTGCTGGACTTTC
    Casq2 ACAACACCAACAATCCTGACCTGAG GTCTTCTCCCAGTAGGCAACAAGC
    Bard1 AGGCAAACAGGGCTCTCAGAAAAC GAAGGTAGTGGACAAGGCGAATGG
    Lck AGCATAACGGTGAATGGTGGAAGG CTTGCGGCTCAGGCTCTTGAAG
    Jak3 GTGCTGCTCAAGGTGCTGGATG ACACGAGATGCGGGTAGGACAC
    Rasgrp3 CACGCCTCAAAGAGACCCATTCC TGAAACCATCACAGTCGGCAAAGG
    Adipoq TTTGTGTACCGCTCAGCCTTCAG GTGGTGCCATCGTAGTGGTTCTG
    Gh1 GCTGATGCGGGAACTAGAAGATGG TCGTTGCTGCGTAAGTTGGTGTC
    C-kit GGCAAGATTTGTGTGTTGTCT AGATGAAGGGAGAAACTGCTC
    Gapdh CATGTCTGGCAAAGTGGATAT CGTGGGTAGAATCATACTGGA
     | Show Table
    DownLoad: CSV

    3.   Results

    3.1.   The effect of SYGC in guinea pig with SOD

    After the model was successfully constructed, the SYGC and positive drug (IRE1 inhibitor) were administered for four weeks. The control group was given the same dose of physiological saline solution. Compared with the normal group, the sphincter tissue of the model group showed edema, increased inflammatory cell infiltration (Figure 2) and decreased c-kit expression (Figure 3), and the ring muscle had partial disorders and irregularities. Also, symptoms such as submucosal fibrous tissue hyperplasia and smooth muscle hypertrophy appeared. After treatment with SYGC or IRE1 inhibitor, the sphincter tissue showed increased c-kit expression and decreased inflammation infiltration, and ring muscle disorders were reduced, suggesting an improved Cajal cell activity in the Oddi sphincter. In addition, compared with the normal group, the serum ALT and AST levels in the model group were significantly higher (P < 0.01). Compared with the model group, the serum ALT levels in G and IR group were significantly decreased (P < 0.01) (Figure 3), indicating that Shaoyao Gancao Decoction can improve the liver function of SOD guinea pigs.

    Figure 2.  Histomorphology of Oddi sphincter of guinea pigs in each group. A: control group (N), B: SOD group (M), C: SYGC gavage treatment group (G), D: IRE1 inhibit treatment group.
    DownLoad: Full-Size Img PowerPoint
    Figure 3.  Levels of C-Kit mRNA, ALT and AST expression of guinea pigs in each group. **P < 0.01.
    DownLoad: Full-Size Img PowerPoint

    3.2.   Identification of compounds and related pharmacological parameters of SYGC

    To identify the major chemical components, the SYGC samples were analyzed using the UHPLC-Q-Exactive Orbitrap HR-MS analysis. As shown in Figure 4 and Table 2, 23 compounds were identified under in positive ion mode and 88 compounds were identified under in negative ion mode. Then, Swissadme was applied to explore the pharmacological parameters of these compounds. Finally, 32 candidate compounds passed the parameters (Lipinski's "rule of five, " Ghose #violations and GI absorption) and were selected for further research (Table 3). Specifically, 6 ingredients were from Paeonia lactiflora Pall., 22 from Glycyrrhiza uralensis Fisch., and 4 from both herbs.

    Figure 4.  Total ion current diagram of SYGC decoction.
    DownLoad: Full-Size Img PowerPoint
    Table 2.  The detailed information of chemical components derived from SYGC by UPLC-Q/TOF-MS.
    No. RT/min Ion mode Measured mass /Da Calculated mass /Da Error/ppm MS/MS Molecular formula Identification Source
    1 0.84 [M-H]- 173.1034 173.1033 0.681 173.10339;156.07675;131.08128 C6H14N4O2 Arginine* M.H.
    2 0.88 [M+FA-H]- 195.0501 195.0499 1.030 195.05022;177.03963;129.01799;99.00733 C5H10O5 Arabinose[x] M.H.
    3 0.89 [M+H]+ 118.0867 118.0863 3.598 118.08656;100.07622;72.08146 C5H11NO2 Valine[x] M.H.
    4 0.89 [M+H]+ 138.0551 138.0550 1.267 138.05498;110.06044;94.06567 C7H7NO2 Trigonelline[x] M.H.
    5 0.90 [M-H]- 179.0550 179.0550 0.142 179.055 C6H12O6 Glucose* M.H.
    6 0.90 [M+FA-H]- 549.1670 549.1661 1.547 549.16809;503.16235;341.10956;179.05505 C18H32O16 Raffinose[x] M.H.
    7 0.96 [M-H]- 341.1087 341.1078 2.616 341.10913;179.05518;119.03361;89.02291 C12H22O11 Sucrose* M.H.
    8 0.98 [M-H]- 191.0552 191.0550 1.023 191.01898;111.00737;87.00727 C7H12O6 Quinic acid* M.H.
    9 1.01 [M-H]- 149.0080 149.0081 -0.633 149.09593;92.92764 C4H6O6 Tartaric acid[x] M.H.
    10 1.09 [M-H]- 133.0128 133.0131 -2.404 133.01285;115.00210;89.02249;71.01216 C4H6O5 Malic acid[x] M.H.
    11 1.09 [M-H]- 115.0022 115.0026 -3.175 115.00217;71.01230 C4H4O4 Maleic acid[x] M.H.
    12 1.29 [M+H]+ 123.0557 123.0553 3.093 123.05553;108.05737;95.08607;80.05014 C6H6N2O Nicotinamide[x] M.H.
    13 1.33 [M+H]+ 144.1020 144.1019 0.797 144.10194;100.35320;84.08141 C7H13NO2 Stachydrine* GC
    14 1.42 [M-H]- 191.0187 191.0186 0.581 191.01889;173.00797;111.00725;87.00718 C6H8O7 Citric acid[x] M.H.
    15 1.46 [M+H]+ 130.0501 130.0499 1.848 130.05000;84.04503 C5H7NO3 Pyroglutamic acid[x] M.H.
    16 1.58 [M+H]+ 182.0814 182.0812 1.374 182.13684;165.05475;136.07573;119.04947 C9H11NO3 Tyrosine* M.H.
    17 2.01 [M-H]- 169.0131 169.0131 -0.235 169.0133;125.0231 C7H6O5 Gallic acid* M.H.
    18 2.08 [M+H]+ 152.0569 152.0567 1.273 152.05675;135.03027;110.03525 C5H5N5O Guanine* M.H.
    19 2.09 [M-H]- 282.0843 282.0833 3.527 282.08444;150.04097;133.01430;108.01913 C10H13N5O5 Guanosine* M.H.
    20 2.13 [M+H]+ 166.1229 166.1226 1.681 166.12270;149.09624;121.10149;93.07048 C10H15NO Hordenine[x] GC
    21 3.59 [M+H]+ 166.0865 166.0863 1.233 166.0862;148.11176;124.03969;106.06532 C9H11NO2 L-Phenylalanine* M.H.
    22 6.51 [M-H]- 183.0290 183.0288 0.984 183.02908;168.00549;139.03885;124.01530 C8H8O5 Methyl Gallate* SY
    23 6.66 [M-H]- 203.0819 203.0815 1.703 203.08202;159.09161;142.06496;116.04915 C11H12N2O2 Tryptophan[x] M.H.
    24 7.42 [M-H]- 285.0615 285.0605 3.600 285.06174;152.01036;108.02022 C12H14O8 Uralenneoside[x] GC
    25 7.69 [M-H]- 165.0546 165.0546 -0.307 165.05461;141.78123;121.06437;93.03300 C9 H10O3 Phloretic acid[x] GC
    26 8.40 [M+FA-H]- 389.1455 389.1442 3.229 389.14597;343.14001;181.08600;151.07516 C16H24O8 Mudanpioside F[y] SY
    27 8.44 [M-H]- 289.0718 289.0707 3.755 289.07199;245.08183;203.07066;109.02801 C15H14O6 (+)-Catechin* SY
    28 8.73 [M-H]- 121.0281 121.0284 -2.280 121.02818;119.04868;94.02834 C7H6O2 4-Hydroxybenzaldehyde[x] GC
    29 9.64 [M-H]- 179.0340 179.0339 0.362 179.03398;135.04384;107.04886 C9H8O4 Caffeic acid* M.H.
    30 9.70 [M-H]- 543.1178 543.1167 2.057 543.15491;255.06639;135.00732;119.04897 C23H28O13S Paeoniflorin Sulfite[y] SY
    31 9.88 [M-H]- 495.1507 495.1497 2.014 495.15140;281.06665;137.02313;93.03300 C23H28O12 Oxypaeoniflorin* SY
    32 12.53 [M-H]- 121.0279 121.0284 -4.511 121.02815;119.04897;93.03310 C7H6O2 3-Hydroxybenzaldehyde* SY
    33 12.54 [M+H]+ 197.0810 197.0808 0.632 197.08055;179.07030;133.06485;105.07025 C10H12O4 Paeonilactone B[y] SY
    34 12.55 [M+FA-H]- 525.1610 525.1603 1.414 525.16180;479.15598;283.08264;121.02814 C23H28O11 Albiflorin* SY
    35 12.74 [M+H]+ 319.1180 319.1176 1.050 319.11862;197.08090;151.07539;105.03388 C17H18O6 Paeoniflorigenone* SY
    36 12.87 [M-H]- 163.0389 163.0390 -0.678 163.03896;119.04886 C9H8O3 p-Coumaric acid[x] M.H.
    37 13.01 [M-H]- 197.0447 197.0445 1.219 197.04483;182.02116;166.99760;123.00723 C9H10O5 Ethyl Gallate* SY
    38 14.02 [M+H]+ 195.0654 195.0652 1.306 195.06525;180.04169;135.04424 C10H10O4 Ferulic acid* SY
    39 14.10 [M+FA-H]- 525.1611 525.1603 1.529 525.16205;449.14566;327.10876;121.02717 C23H28O11 Paeoniflorin* SY
    40 14.12 [M-H]- 121.0272 121.0284 -9.964 121.02805;119.04849;93.03285 C7H6O2 2-Hydroxybenzaldehyde SY
    41 14.58 [M-H]- 593.1513 593.1501 2.046 593.15198;473.10907;383.07767;353.06711 C27H30O15 Vcenin-II[x] GC
    42 14.88 [M+H]+ 179.0341 179.0339 1.367 179.07022;151.07547;133.06494;105.07031 C9H6O4 5, 7-Dihydroxycoumarin[x] GC
    43 15.89 [M-H]- 417.1193 417.1180 3.072 417.11948;255.06616;153.01817;119.04880 C21H22O9 Neoliquiritin* GC
    44 16.29 [M-H]- 563.1405 563.1395 1.719 563.14099;443.09879;383.07742;353.06689 C26H28O14 Schaftoside[x] GC
    45 16.58 [M-H]- 137.0231 137.0233 -1.683 137.0232; 93.0332 C7H6O3 3, 4-Dihydroxybenzaldehyde* M.H.
    46 16.60 [M-H]- 563.1405 549.1603 1.719 549.16174;429.10385;255.06619;135.00745 C26H30O13 Naringenin 7-O-(2-β-D-Apiofuranosyl)-β-D-glucopyranoside[x] GC
    47 16.64 [M-H]- 563.1404 563.1395 1.613 563.14105;473.10779;383.07770;353.06702 C26H28O14 Isoschaftoside[x] GC
    48 16.73 [M-H]- 417.1190 417.1180 2.281 417.11957;255.06628;153.01817;135.00742 C21H22O9 Liquiritin* GC
    49 17.03 [M+H]+ 581.1873 581.1865 1.339 581.18451;419.13376;257.08060;137.02328 C27H32O14 Isoliquiritigenin-4, 4'-diglucoside[x] GC
    50 17.34 [M+H]+ 465.1036 465.1028 1.715 465.11786;333.18991;135.11693;107.08585 C21H20O12 Hyperin* SY
    51 17.52 [M-H]- 549.1613 549.1603 1.917 549.16064;255.06677;153.01819;119.04881 C26H30O13 Liquiritin apiroside[x] GC
    52 17.73 [M-H]- 631.1669 631.1658 1.780 631.16779;491.11960;313.05685;169.01320 C30H32O15 Galloylpaeoniflorin* SY
    53 18.82 [M+H]+ 465.1037 465.1028 2.102 465.11781;285.07422;153.12750;135.11693 C21H20O12 Isoquercitrin* SY
    54 19.21 [M+H]+ 301.0709 301.0707 0.749 301.07056;286.04709;167.03397;105.03389 C16H12O6 Pratensein[x] GC
    55 19.24 [M-H]- 433.1140 433.1129 2.440 433.11423;271.06122;151.00252;119.04887 C21H22O10 Chalconaringenin 4-​O-​glucoside[x] GC
    56 19.73 [M+H]+ 579.1715 579.1708 1.171 579.17090;325.07077;121.02876 C27H30O14 Violanthin[x] GC
    57 20.11 [M+H]+ 481.1711 481.1704 1.272 481.19099;197.08093;133.06490;105.03391 C23H28O11 Mudanpioside I SY
    58 20.14 [M-H]- 301.0716 301.0707 2.974 301.07159;286.04800;191.03429;150.03105 C16H14O6 Hesperetin* GC
    59 20.27 [M+H]+ 301.0708 301.0707 0.549 301.07059;167.03403;105.03387 C16H12O6 Rhamnocitrin[x] GC
    60 20.53 [M+FA-H]- 507.1504 507.1497 1.415 507.15225;461.14590;339.10834;177.05472 C23H26O10 Lactiflorin* SY
    61 20.68 [M-H]- 431.0982 431.0973 2.173 431.09805;268.03763 C21H20O10 kaempferol-3-rhamnoside[x] GC
    62 21.55 [M-H]- 255.0661 255.0652 3.547 255.06625;153.01811;135.00746;119.04885 C15H12O4 Liquiritigenin* GC
    63 22.01 [M-H]- 417.1190 417.1180 2.425 417.11951;255.06613;119.04876 C21H22O9 Isoliquiritin* GC
    64 22.09 [M-H]- 549.1616 549.1603 1.465 549.16174;255.06610;135.00732 C26H30O13 Isoliquiritin Apioside[x] GC
    65 22.22 [M-H]- 459.1298 459.1286 2.715 459.13025;255.06625;153.01826;119.04884 C23H24O10 6'-Acetyliquiritin[x] GC
    66 22.28 [M+FA-H]- 475.1245 475.1235 2.205 475.12463;267.06631;252.04248 C22H22O9 Ononin* GC
    67 22.31 [M+H]+ 563.1763 563.1759 0.733 563.17450;269.08069 C27H30O13 Glycyroside[x] GC
    68 22.57 [M-H]- 591.1721 591.1708 2.179 591.17230;549.16211;255.06621;135.00746 C28H32O14 Liquiritigenin-4′-O-[β-D-3-O-acetyl-apiofuranosyl-(1-2)]-β-D-glucopyranoside[x] GC
    69 22.71 [M-H]- 285.0768 285.0758 3.613 285.07687;270.05347;177.01819;150.03105 C16H14O5 Licochalcone B* GC
    70 22.88 [M-H]- 549.1614 549.1603 2.026 549.16180;417.11899;255.06616;153.01814 C26H30O13 Licuraside[x] GC
    71 23.19 [M-H]- 263.1290 263.1278 4.501 263.12851;219.13876;104.11462;151.07529 C15H20O4 (+)-Asycisic acid[x] M.H.
    72 23.25 [M-H]- 599.1773 599.1759 2.324 599.17773;281.06717;137.02309;93.03311 C30H32O13 Benzoyloxypaeoniflorin* SY
    73 23.90 [M+H]+ 255.0653 255.0652 0.489 255.06505;137.02332;85.57477 C15H10O4 Daidzein* GC
    74 24.03 [M-H]- 695.1986 695.1970 2.249 695.19916;531.15088;255.0612;135.00742 C35 H36 O15 Licorice-glycoside B/D1/D2[x] GC
    75 24.08 [M-H]- 299.0559 299.0550 3.095 299.05618;284.03284;199.03935;147.00769 C16H12O6 7, 2', 4'－Trihydroxy-5-methoxy-3-arylcoumarin[x] GC
    76 25.71 [M-H]- 285.0768 285.0758 3.718 285.07684;270.05359;177.01857;150.03105 C16H14O5 Homobutein[x] GC
    77 25.91 [M+FA-H]- 491.1196 491.1184 2.499 491.12021;329.13995;153.01823;109.02785 C22H22O10 Trifolirhizin[x] GC
    78 26.27 [M-H]- 269.0819 269.0808 4.105 269.046 C16H14O4 Echinatin[x] GC
    79 26.60 [M-H]- 725.2094 725.2076 2.398 725.20972;531.15088;255.06610;135.00740 C36 H38O16 Licorice-glycoside A/C1/C2 GC
    80 27.02 [M+FA-H]- 629.1876 629.1865 1.809 629.18817;583.18237;121.02798 C30H32O12 Benzoylalbiflorin* SY
    81 27.17 [M+H]+ 287.0552 287.0550 0.681 287.05493;151.03905;121.02861 C15H10O6 Kaempferol* M.H.
    82 27.54 [M+FA-H]- 629.1877 629.1865 1.999 629.18726;583.18323;553.17212;121.02816 C30H32O12 Benzoylpaeoniflorin* SY
    83 27.54 [M-H]- 301.0716 301.0707 3.173 301.07151;286.04802;191.03429;150.03101 C16H14O6 Tetrahydroxymethoxychalcone[x] GC
    84 28.31 [M-H]- 255.0660 255.0652 3.233 255.06618;153.01802;135.00734;119.04870 C15H12O4 Isoliquiritigenin* GC
    85 29.71 [M-H]- 267.0662 267.0652 3.650 267.06635;252.04263 C16H12O4 Formononetin* GC
    86 31.54 [M-H]- 837.3913 837.3903 1.162 837.39191;775.39111;485.32816;351.05701 C42H62O17 Licorice saponin P2[x] GC
    87 31.90 [M-H]- 895.3972 895.3958 1.579 895.39838;628.15387;351.05673;113.02299 C44H64O19 Uralsaponin F[x] GC
    88 33.09 [M-H]- 853.3866 853.3852 1.592 853.38739;351.05695;289.05539;113.02303 C42H62O18 22-Hydroxy-licorice saponin G2[x] GC
    89 33.46 [M-H]- 819.3817 819.3798 2.377 819.38220;573.36359;351.05740;193.03456 C42H60O16 Licorice saponin E2[x] GC
    90 34.04 [M-H]- 879.4027 879.4009 2.068 879.40271;581.34503;351.05740 C44H64O18 22-Acetoxyl-glycyrrhizin[x] GC
    91 34.42 [M-H]- 983.4498 983.4482 1.622 983.44983;821.39618;627.35510;351.05698 C48H72O21 Licorice saponin A3[x] GC
    92 34.82 [M-H]- 863.4077 863.4060 1.938 863.40833;758.07990;351.05658;193.03439 C44H64O17 22β-Acetoxyglycyrrhaldehyde[x] GC
    93 35.27 [M-H]- 353.1030 353.1020 2.932 353.10287;284.03271;125.02303 C20H18O6 Licoisoflavone A[x] GC
    94 35.46 [M-H]- 353.1395 353.1384 3.341 353.13989;173.03392;165.01820;125.02313 C21H22O5 Gancaonin I[x] GC
    95 35.57 [M-H]- 837.3920 837.3903 1.962 837.39221;732.52264;351.05753;193.03474 C42H62O17 Licorice saponin Q2[x] GC
    96 36.42 [M-H]- 367.1186 367.1176 2.575 367.11871;309.04059;203.07121 C21H20O6 Glycycoumarin[x] GC
    97 37.02 [M-H]- 353.1031 353.1020 3.187 353.10321;297.04050 C20H18O6 Licoflavonol[x] GC
    98 37.71 [M-H]- 837.3919 837.3903 1.819 837.39270;732.47290;351.05701 C42H62O17 Licorice saponin G2[x] GC
    99 37.90 [M-H]- 337.1447 337.1434 3.780 337.10840;282.05301 C21H22O4 Licochalcone A* GC
    100 38.15 [M-H]- 351.0875 351.0863 3.262 351.08752;333.07715;283.09756;177.01840 C20H16O6 Licoisoflavone B[x] GC
    101 38.44 [M-H]- 837.3919 837.3903 1.891 837.39282;607.58362;351.05847;193.03423 C42H62O17 Uralsaponin N[x] GC
    102 38.61 [M-H]- 967.4548 967.4533 1.560 967.45569;860.47540;497.11691 C48H72O20 Rhaoglycyrrhizin[x] GC
    103 39.22 [M-H]- 821.3973 821.3954 2.274 821.39740;724.18427;589.77423;351.05710 C42H62O16 Glycyrrhizic acid* GC
    104 39.22 [M-H]- 823.4035 823.4111 -9.184 823.41315;574.30713;351.05688;113.02302 C42H64O16 Uralsaponin C[x] GC
    105 39.64 [M-H]- 821.3972 821.3954 2.201 821.39734;351.05698;193.03477;113.02299 C42H62O16 Licorice saponin H2[x] GC
    106 40.54 [M-H]- 807.4181 807.4161 2.406 807.41821;351.05682;193.03471;113.02308 C42H64O15 Licoricesaponin B2[x] GC
    107 40.69 [M-H]- 985.4656 985.4639 1.720 985.46442;497.11523;321.08276;113.02301 C48H74O21 Yunganoside D1 or Yunganoside G1[x] GC
    108 40.77 [M-H]- 807.4186 807.4161 2.333 807.41840;351.05688;193.03471;113.02303 C42H64O15 22-Dehydroxyural saponin[x] GC
    109 40.90 [M-H]- 821.3978 821.3954 2.203 821.39771;351.05685;193.03465;113.02307 C42H62O16 Licorice Saponin K2[x] GC
    110 40.96 [M-H]- 823.4038 823.4111 -8.880 823.41223;351.05713;193.03426;113.02285 C42H64O16 Licorice Saponin SJ2[x] GC
    111 42.81 [M-H]- 255.2327 255.2319 3.461 255.13889;149.09576;119.04839;93.03307 C16H32O2 Palmitic Acid[x] M.H.
    *Note: * means that the ingredient was confirmed by the reference substance (Supplementary material); [x] means that ingredient was confirmed by the reference literature "Chinese Journal of Natural Medicines, 19 (2021), 305–320. https://doi.org/10.1016/S1875-5364(21)60031-6"; [y] means that ingredient was confirmed by the reference literature "Journal of Chinese Mass Spectrometry Society, 35 (2014), 269–278. https://doi.org/10.7538/zpxb.2014.35.03.0269"; SY: Paeonia lactiflora Pall., GC:Glycyrrhiza uralensis Fisch., M.H.:SY and GC.
     | Show Table
    DownLoad: CSV
    Table 3.  Chemical properties statistics of 32 potential active hub components from SYGC.
    Identification GI absorption Lipinski # violations Ghose # violations MW Rotatable bonds H-bond acceptors H-bond donors TPSA
    Hordenine High 0 0 165.23 3 2 1 23.47
    Methyl Gallate High 0 0 184.15 2 5 3 86.99
    Phloretic acid High 0 0 166.17 3 3 2 57.53
    (+)-Catechin High 0 0 290.27 1 6 5 110.38
    Caffeic acid High 0 0 180.16 2 4 3 77.76
    Paeonilactone B High 0 0 196.2 0 4 1 63.6
    Paeoniflorigenone High 0 0 318.32 4 6 1 82.06
    p-Coumaric acid High 0 0 164.16 2 3 2 57.53
    Ethyl Gallate High 0 0 198.17 3 5 3 86.99
    Ferulic acid High 0 0 194.18 3 4 2 66.76
    Pratensein High 0 0 300.26 2 6 3 100.13
    Hesperetin High 0 0 302.28 2 6 3 96.22
    Rhamnocitrin High 0 0 300.26 2 6 3 100.13
    Liquiritigenin High 0 0 256.25 1 4 2 66.76
    Ononin High 0 0 430.4 5 9 4 138.82
    Licochalcone B High 0 0 286.28 4 5 3 86.99
    Daidzein High 0 0 254.24 1 4 2 70.67
    7, 2', 4'－Trihydroxy-5-methoxy -3-arylcoumarin High 0 0 300.26 2 6 3 100.13
    Homobutein High 0 0 286.28 4 5 3 86.99
    Trifolirhizin High 0 0 446.4 3 10 4 136.3
    Echinatin High 0 0 270.28 4 4 2 66.76
    Kaempferol High 0 0 286.24 1 6 4 111.13
    Tetrahydroxymethoxy chalcone High 0 0 302.28 4 6 4 107.22
    Isoliquiritigenin High 0 0 256.25 3 4 3 77.76
    Formononetin High 0 0 270.28 2 4 1 55.76
    Licoisoflavone A High 0 0 354.35 3 6 4 111.13
    Gancaonin I High 0 0 354.4 5 5 2 72.06
    Glycycoumarin High 0 0 368.38 4 6 3 100.13
    Licoflavonol High 0 0 354.35 3 6 4 111.13
    Licochalcone A High 0 0 338.4 6 4 2 66.76
    Licoisoflavone B High 0 0 352.34 1 6 3 100.13
    Palmitic Acid High 1 0 256.42 14 2 1 37.3
     | Show Table
    DownLoad: CSV

    3.3.   Identification of target genes of SYGC

    The target information of 32 active ingredients was obtained from HERB, SwisstargetPrediction and BATMANTCM. Once duplicate genes were deleted, a total of 1023 targets for SYGC were obtained.

    3.4.   Identification of SOD differential expression genes and functional enrichment analysis

    Furthermore, we explored the dysfunctional genes and pathways in guinea pig SOD using RNA-Seq of sphincter tissues from the Control and SOD groups. The RNA from the three replicate samples from the control and SOD groups was sequenced. In all, 16,281 genes were identified (Supplementary data). To determine the differentially expressed genes (DEGs), a q-value < 0.05 was used as the cut-off value for gene expression in the control and SOD groups using DESeq2. As a result, 649 DEGs including 247 up-regulated and 402 down-regulated genes were screened (Figure 5A). The top 10 enriched GO terms in each category as cellular component (CC), molecular function (MF), biological process (BP) and of the identified DEGs are shown in Figure 5B. The GO terms showed that DEGs were mainly related to negative regulation of cell fate commitment, extracellular space, serine-type endopeptidase inhibitor activity, etc. On the other hand, the results of KEGG enrichment analysis showed that the top enriched KEGG terms were, for example, complement and coagulation cascades, B cell receptor signaling pathway, primary immunodeficiency NF-kappa B signaling pathway (Figure 5C).

    Figure 5.  Identification and functional enrichment analyses of DEGs. A: Heatmap of the up- and down-regulated DEGs. B: The top 30 enriched GO terms for DEGs in biological process, molecular function and cellular component categories. C: The top 20 enriched KEGG pathways for DEGs. N: control group, M: SOD group.
    DownLoad: Full-Size Img PowerPoint

    3.5.   Determination of SOD-related genes targeted by SYGC and functional enrichment analysis

    To identify the intersecting genes between SYGC and SOD, a Venn analysis was performed on the target genes of SYGC and SOD DEGs. As shown in Figure 6A, 52 genes were identified as intersecting genes of SYGC and SOD. Then, these intersecting genes were imported into the Metascape database to carry out GO enrichment analysis and pathway enrichment analysis (Figure 6B). BP terms were mainly found in regulation of ion transport, response to xenobiotic stimulus and leukocyte migration. CC terms were mainly enriched in ion channel complex, side of membrane, and perinuclear region of cytoplasm. MF terms were mainly present in kinase binding, kinase binding-membrane spanning protein tyrosine kinase activity and carbonate dehydratase activity. These factors can exert therapeutic effects on SOD.

    Figure 6.  GO and KEGG pathway enrichment analysis of intersecting targets between SYGC and SOD DEGs. A: Venn diagram of the predicted targets of SYGC in SOD. B: The top 30 enriched GO terms for intersecting targets in biological process, molecular function and cellular component categories. C: Enriched KEGG pathways for intersecting targets.
    DownLoad: Full-Size Img PowerPoint

    In addition, the results of the pathway enrichment analysis mainly involved the B cell receptor signaling pathway, complement system, signaling by receptor tyrosine kinases, Interleukin-4 and Interleukin-13 signaling, as well as muscle contraction, among others (Figure 6C).

    3.6.   Analysis of protein-protein interaction network of gene intersection and construction of a regulatory network of targets for the treatment of SOD with SYGC

    The STRING database (http://www.string-db.org) was used to investigate the target genes' interactions. There were 57 nodes and 158 edges in the protein-protein interaction network. Then, the complex interactions between active components and potential target genes were visualized using the Cytoscape, including 82 nodes and 214 edges (Figure 7A). Four significant clusters were obtained from ClusterONE analysis (node ≥ 3 and P < 0.05). Cluster 1 consisted of 10 nodes (Figure 7B); Cluster 2 consisted of 11 nodes (Figure 7C); Cluster 3 consisted of 8 nodes (Figure 7D); Cluster 4 consisted of 3 nodes (Figure 7E). Four significant modules were obtained from MCODE analysis (score ≥ 3). Module 1 (score: 8.75) consisted of 9 nodes (Figure 7F); Module 2 (score: 7.125) consisted of 17 nodes (Figure 7G); module 3 (score: 3.6) consisted of 6 nodes (Figure 7H); module 4 (score: 3) consisted of 3 nodes (Figure 7I). Finally, 20 intersecting genes between MCODE genes and ClusterONE genes were obtained, including SERPINE1, MMP9, PLG, CCNB1, CACNA2D2, RAD51, CHRNB4, AURKB, TOP2A, TYMS, KIF11, KCNQ1, CASQ2, BARD1, CHRNA4, IGFBP1, TNNT2, SCN4A, MKI67, CMA1.

    Figure 7.  MCODE and ClusterONE analysis of the component-target network. A: The protein-protein interaction network of the intersecting targets, B–E: clusters 1–4, F–I: modules 1–4. Red boxes represent chemicals in SYGC, green boxes represent intersecting targets between SYGC and SOD DEGs, and yellow boxes represent interaction proteins in the STRING database.
    DownLoad: Full-Size Img PowerPoint

    3.7.   Molecular docking validation

    The present study examined the intersecting genes between MCODE and ClusterONE genes involved in the B cell receptor signaling pathway (AURKB, KIF11) and complement system (PLG). Each of the enriched components is docked with the three genes. The binding energy of ligands in PDB structures was used for positive control (VX6 for AURKB: -8.8 kcal/mol, GCE for KIF11: -9.5 kcal/mol, XO3 for PLG: -7 kcal/mol). Glycycoumarin and licoflavonol exert lower score than VX4 ligand for AURKB target, indicating a strong binding activity. Rhamnocitrin shows a relative lower score compared to GCE ligand for KIF11 target, indicating a good binding activity. Echinatin, homobutein and licoflavonol present a relative lower score compared to XO3 ligand for PLG target, suggesting a good binding activity (Table 4).

    Table 4.  The protein-ligand binding energy of molecular docking results (kcal/mol).
    Ligand Group AURKB (4af3) KIF11 (6hky) PLG (4cik)
    VX6_AURKB control -8.8 - -
    GCE_KIF11 - -9.5 -
    XO3_PLG - - -7
    Echinatin SYGC -8.4 -8.2 -6.4
    Ethyl Gallate -6.3 -6.1 -5.4
    Glycycoumarin -9.3 -7.9 -6.3
    Hesperetin -8.7 -8.6 -5.9
    Homobutein -8.2 -8.2 -6.4
    Kaempferol -8.8 -8.8 -6.3
    Licoflavonol -9.1 -7.5 -6.4
    Methyl Gallate -6.2 -6.2 -5.4
    Palmitic Acid -6.3 -6.2 -5
    Rhamnocitrin -8.3 -9 -6.3
     | Show Table
    DownLoad: CSV

    Specifically, AURKB showed 12 interactions with glycycoumarin, including unfavorable donor- donor, Pi-sigma, Pi-alkyl and Alkyl, which were connected with GLU 161, LEU 83, ALA 157, VAL 91 and PHE 88 (Figure 8A). It showed 13 interactions with licoflavonol including carbon hydrogen bond, conventional hydrogen bond, unfavorable donor- donor, Pi-sigma, Pi-alkyl and Alkyl, which were connected with VAL 91, LYS 106, ALA 157, GLU 161 and GLY 160 (Figure 8B). KIF11 showed 8 interactions with rhamnocitrin, including conventional hydrogen bonds, Pi-sigma, Pi-alkyl and Pi-anion, which were connected with TRP 127, PRO 137, ALA 133, GLU 116 and ARG 119 (Figure 8C). PLG showed 6 interactions with echinatin including carbon hydrogen bond, conventional hydrogen bond, unfavorable donor- donor, Pi-cation, Pi-Pi stacked and Pi-Pi T-shaped, which were connected with TYR 72, ASP 55, ARG 71, TRP 62 and ARG 35 (Figure 8D). It showed 6 interactions with homobutein including carbon hydrogen bond, Pi-donor hydrogen bond, Pi-Pi stacked, Pi-Pi T-shaped, Pi-anion, Pi-alkyl and Pi-cation, which were connected with ARG 35, TRP 62, TYR 72, ASP 55 and ARG 71 (Figure 8E). It showed 9 interactions with licoflavonol including carbon hydrogen bond, Pi-Pi stacked, Pi-Pi T-shaped, Pi-anion, Alkyl and Pi-cation, which were connected with ASP 55, TRP 62, TYR 72, ASP 57 and ARG 35 (Figure 8F).

    Figure 8.  The docking model diagram of the active ingredient of the drug and the core target. A: AURKB-glycycoumarin, B: AURKB-licoflavonol, C: KIF1-rhamnocitrin, D: PLG-echinatin, E: PLG-homobutein, F: PLG-licoflavonol.
    DownLoad: Full-Size Img PowerPoint

    3.8.   Verifying of hub genes

    To verify the results of bioinformatics analysis, we obtained the top eight genes (Prkcb, Alox5, Adora2a, Lck, Jak3, Rasgrp3, Adipoq and Gh1) involved in the 52 gene-related signal pathways and 14 intersecting genes (Serpine1, Mmp9, Plg, Ccnb1, Cacna2d2, Rad51, Chrnb4, Aurkb, Top2a, Tyms, Kif11, Kcnq1, Casq2 and Bard1) among MCODE genes, ClusterONE genes and genes of significant enrichment pathways. We detected the mRNA expression levels of these genes by RT-qPCR in the Oddi sphincter tissues. Compared with the control group, the M group showed decreased expression of Ccnb1, Mmp9, Rad51, Top2a, Tyms, Kif11, Rasgrp3, Prkcb, Lck, Jak3, Adora2a, Aurkb and Gh1 and increased expression of Cacna2d2, Chrnb4, Alox5 and Plg. Moreover, the expression of Ccnb1, Cacna2d2 and Chrnb4 returned to normal after SYGC treatment (Figure 9).

    Figure 9.  Validation of the mRNA expression levels of hub genes. *P < 0.05, **P < 0.01.
    DownLoad: Full-Size Img PowerPoint

    4.   Discussion

    SOD is a key secondary pathological change in the context of gallbladder- and pancreas-related inflammatory diseases and seriously impacts patients' quality of life [18,19]. At present, the research on its pathogenesis and effective treatment are in the preliminary stages. TCM has been widely applied for the discovery of candidate drugs [20]. SYGC is used for the treatment of pain-related diseases with reducing muscle tension, relieving spasms and providing analgesia [21]. Moreover, paeoniflorin, an extract of Shaoyao, can relax the SO muscle via reducing calcium ion influx [22]. Isoliquiritigenin, a flavonoid from licorice, relaxed guinea-pig tracheal smooth muscle through the cGMP/PKG pathway [23]. Consistent with our clinical study [7], we also found that SYGC administration can repair the structure and ultrastructure of the SO in vivo with decreased inflammation infiltration and ring muscle disorders. However, the detailed regulatory mechanism of SYGC action against SOD requires further investigation.

    Therefore, we used the systematic pharmacological method to discover the potential molecular mechanisms of SYGC on SOD. At first, a total of 649 DEGs were identified in SOD, which were mainly enriched in complement and coagulation cascades, B cell receptor signaling pathway, primary immunodeficiency and NF-kappa B signaling pathway. Recently, it was well established that immune disorders and inflammation played an important role in the occurrence and development of numerous diseases, including SOD [24,25,26]. The B cell receptor (BCR) signaling pathway was crucial for normal B cell development and adaptive immunity [27], and B cell-derived IgE may lead to smooth muscle contraction induced by the degranulation of mast cells [28]. NF-κB showed a key role in various biological processes, including inflammation, immune response, cell growth and survival and development [29,30,31]. NF-κB signaling impeded the recovery of skeletal muscle function after damage [32]. In addition, NF-kappaB activation served as a survival factor in B cell, which prevented cell apoptosis [33,34]. These results suggest that SOD may exert a dysfunction crosstalk between B cell receptor and NF-κB signaling pathway.

    Then, does SYGC ameliorate SOD by regulating the B cell receptor signaling pathway? We first identified 32 candidate compounds using UHPLC-Q-Orbitrap-HRMS and network pharmacology analysis. Interestingly, these chemicals had an effect in the B cell receptor signaling pathway. Additionally, SYGC may improve SOD through multiple pathways including the complement system, Interleukin-4 and Interleukin-13 signaling and muscle contraction. Therefore, these results suggest that the B cell receptor signaling pathway may play a central role in these multiple pathways. For example, IL-4 and IL-13 exerted their signaling action by IL-4Rα/IL-13Rα complexes [35], and IL-4 was demonstrated to regulate B-cell receptor signaling in chronic lymphocytic leukemia [36]. The complement system, an essential contributor of innate immunity, was also important in regulating B cell responses at multiple stages of the peripheral response [37]. Combined with the effect of SYGC on muscle cramps [4,38], we speculate that SYGC improve SOD through relieving immune and inflammation dysfunction.

    Additionally, we discovered three genes associated with the B cell receptor signaling pathway and complement system in the SYGC treatment of SOD, namely AURKB, KIF11 and PLG. Aurora kinase B (AURKB), which belongs to the mitotic protein kinase family, played a role in mitosis and the inflammatory pathway through of NF-κB transcription [39,40]. The plasminogen protein encoded by PLG can regulate skeletal muscle regeneration [41] and the resolution of inflammation through macrophage polarization and efferocytosis [42]. Moreover, the expression of these 3 genes returned to normal after SYGC treatment. These data imply that the three genes may play a critical role in the SYGC treatment of SOD.

    Furthermore, glycycoumarin, licoflavonol, echinatin and homobutein exert good binding activity with the above three genes. It was reported that glycycoumarin can relax gastrointestinal smooth muscle tone [43] and inhibit tetanic contractions [38]. Echinatin and homobutein exerted favorable pharmacological effects on anti-inflammatory and anti-oxidant activity partly to NF-κB inhibition [44,45,46]. Collectively, these chemical components of SYGC provide the pharmacological basis for the immune and inflammation activities related to SOD.

    5.   Conclusions

    In conclusion, the present study displayed that multi-ingredient therapeutics of SYGC regulated SOD development by multi-targets and multi-pathways. Future studies should be conducted to explore the involvement of these targets in the treatment of SOD with SYGC. In addition, more experiments are still needed to confirm our findings. Nevertheless, our research still provided some reasonable major mediators for the anti-SOD effects of SYGC, including four active compounds (glycycoumarin, licoflavonol, echinatin and homobutein), three targets (AURKB, KIF11 and PLG) and several pathways (B cell receptor signaling pathway, complement system and muscle contraction).

    Acknowledgments

    This work was supported by grants from the National Natural Science Foundation of China (No. 81904017).

    Conflict of interest

    The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.



    [1] Rider G (2003) Reticle Electrostatic Protection Seminar, International Sematech. Available from: https://www.researchgate.net/publication/327228305_Sematech_ESD_Symposium_Field_Simulation_Presentation
    [2] Bellmore D (2002) Controlling ESD In Automated Handling Equipment. Electrical Overstress/Electrostatic Discharge Symposium 226-235.
    [3] Bruner J (2002) Design of Semiconductor Manufacturing Equipment for Electrostatic Compatibility. Sematech ESD Symposium.
    [4] Mechanical specification for a 150 mm reticle SMIF pod (RSP150) used to transport and store a 6 inch reticle. SEMI Standard E111. Available from: https://www.semi.org/en/collaborate/standards
    [5] Montoya J, Levit L, Englisch A (2001) A Study of the Mechanisms for ESD Damage to Reticles. IEEE T Electron Pack 24: 78-85. doi: 10.1109/6104.930957
    [6] Levit L, Weil G (2001) Reticle boxes, ESD Control and Electrostatic Shielding. Sematech ESD Impact and Control Workshop.
    [7] Chubb J (2000) Measuring The Shielding Performance Of Materials. IEEE Industry Applications Conference.
    [8] Rider G (2003) EFM: A Pernicious New Electric Field Induced Damage Mechanism in Reticles. Sematech ESD Symposium. Available from: https://www.researchgate.net/profile/Gavin_Rider/contributions
    [9] Rider G (2003) Quantification of the risk of field induced damage to reticles. Sematech ESD Symposium. Available from: https://www.researchgate.net/profile/Gavin_Rider/contributions
    [10] Rudack AC, Pendley M, Gagnon P, et al. (2003) Induced ESD Damage on Photomasks: A Reticle Evaluation. 23rd Annual BACUS Symposium on Photomask Technology 5256: 1136-1142. doi: 10.1117/12.518126
    [11] Helmholz D, Lering M (2006) Reticle Carrier Material as ESD Protection. Photomask Technology 6349: 634952.
    [12] Rider G, Kalkur T (2008) Experimental quantification of reticle electrostatic damage below the threshold for ESD. Metrology, Inspection, and Process Control for Microlithography XXII 6922: 69221Y.
    [13] Rider G (2008) Electric field-induced progressive CD degradation in reticles. Photomask Technology 7122: 71220G.
    [14] Ben-Zvi G, Dmitriev V, Graitzer E, et al. (2008) Very High Sensitivity Mask Transmittance Mapping and Measurements Based on Non Imaging Optics with Galileo. Photomask and Next-Generation Lithography Mask Technology XV 7028:702828. doi: 10.1117/12.798462
    [15] Ben-Zvi G, private communication of data produced by Brian Grenon Consultants.
    [16] Rider G (2008) How to protect reticles from electrostatic damage. SPIE Digital Library, November 2018.
    [17] Montoya J, Levit L, Englisch A (2000) A Study of the Mechanisms for ESD Damage to Reticles. Sematech ESD Symposium.
    [18] Sebald T, Rider G (2009) High sensitivity electric field monitoring system for control of field-induced CD degradation in reticles (EFM). Photomask and Next-Generation Lithography Mask Technology XVI 7379: 73791P.
    [19] Labovitz S, Ben-Zvi G, Dmitriev V, et al. (2008) Detection of Progressive Transmission Loss Due to Haze with Galileo Mask DUV Transmittance Mapping Based on Non Imaging Optics. Photomask Technology 7122: 712216. doi: 10.1117/12.801558
    [20] Sengupta D, Pavlidis D (2003) Control of semiconductor epitaxy by application of an external field. CFD Research Corp Huntsville AL.
    [21] Derenyi I, Lee C, Barabasi AL (1998) Ratchet Effect in Surface Electromigration: Smoothing Surfaces by an AC Field. Phys Rev Lett 80: 1473. doi: 10.1103/PhysRevLett.80.1473
    [22] Ratsch C, Scheffler M (1998) Density Functional Theory Calculations of Hopping Rates of Surface Diffusion. Phys Rev B 58: 13163. doi: 10.1103/PhysRevB.58.13163
    [23] Rudack A, Levit L, Williams A (2002) Mask Damage by Electrostatic Discharge: A Reticle Printability Evaluation. Optical Microlithography XV 4691: 1340-1347. doi: 10.1117/12.474516
    [24] Wallash A, Levit L (2003) Electrical breakdown and ESD phenomena for devices with nanometer-to-micron gaps. Reliability, Testing, and Characterization of MEMS/MOEMS li 4980: 87-96. doi: 10.1117/12.478191
    [25] Diaz CH (1994) Automation of Electrical Overstress Characterization for Semiconductor Devices. Hewlett Packard Journal 45: 106.
    [26] Azizi N, Yiannacouras P (2003) Gate Oxide Breakdown. ECE1768 - Reliability of Integrated Circuits.
    [27] Pey KL, Tung CH (2007) Physical characterization of breakdown in metal-oxide-semiconductor transistors. SPIE Newsroom 2-4.
    [28] Hsu DC, Wang MT, Lee J (2007) Electrical characteristics and reliability properties of metal-oxide-semiconductor field-effect transistors with ZrO2 gate dielectric. J Appl Phys 101: 094105. doi: 10.1063/1.2723861
    [29] Shaw D (2017) Diffusion in Semiconductors. Springer Handbook of Electronic and Photonic Materials.
    [30] Sonnenfeld G, Goebel K, Celaya J (2008) An Agile Accelerated Aging, Characterization and Scenario Simulation System for Gate Controlled Power Transistors. IEEE Autotestcon 208-215.
    [31] Guide for the Handling of Reticles and Other Extremely Electrostatic Sensitive (EES) Items Within Specially Designated Areas. SEMI Standard E163-0212. Available from: http://ams.semi.org/ebusiness/standards/semistandard.asp

  • This article has been cited by:

    1. Liang Kong, Yang Liu, Jia-hua Wang, Mei-jun Lv, Ya-zhu Wang, Wan-ping Sun, Hui-min Cao, Rui-bo Guo, Lu Zhang, Yang Yu, Juan Zang, Lian-qun Jia, Xue-tao Li, Linggui Zhugan decoction ameliorating mitochondrial damage of doxorubicin-induced cardiotoxicity by modulating the AMPK-FOXO3a pathway targeting BTG2, 2025, 139, 09447113, 156529, 10.1016/j.phymed.2025.156529
    2. Haonan Lin, Yixuan Liang, Wangqiang Zhao, Junwei Cao, Tianqi Wang, Changmiao Wang, Reassessing the role of nitric oxide in the pathogenesis of sphincter of Oddi dysfunction, 2025, 13, 2052-0034, 10.1093/gastro/goaf001
  • Reader Comments
  • © 2019 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索
AIMS Electronics and Electrical Engineering
2.4

Metrics

Article views(4412) PDF downloads(455) Cited by(0)

Preview PDF
Download XML
Export Citation
Article outline
Abstract
   Introduction
   Materials and methods
   Results
   Discussion
   Conclusions
Acknowledgments
Conflict of interest
References

Figures and Tables

Figures(9)

Other Articles By Authors

Related pages

Tools

Copyright © AIMS Press

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return

Catalog