1.
Introduction
Generally, mitochondrial dysfunctions are observed in cancerous cells [1]. Furthermore, as we age, the risk of developing cancer increases. This is in contrast to decreasing levels of cellular NAD+ [2]. Previously, it was shown that the cellular NAD+/NADH ratio increases in response to trans-resveratrol (Rsv), 2-deoxy-D-glucose (2DG), 3-aminobenzamide (3AB) and olaparib (AZD2281) (OLA), in HeLa S3 cells [3]. A natural polyphenol, Rsv, which is contained in the skins of grapes, berries and peanuts, not only has an anticancer effect but also extends the life spans of various organisms [4]. Rsv is synthesized in plants in response to various environmental stresses such as fungal infection and UV irradiation [5],[6]. Both cis and trans isomers are known, but biological activities are only reported for the trans isomer (3,5,4′-trihydroxy-trans-stilbene). Generally, Rsv is known to be beneficial for health, preventing obesity, diabetes and inflammatory and neurodegenerative diseases, affecting the cardiovascular system and a cancer-causing signaling pathway [7],[8]. 2DG is a glucose derivative that limits glycolysis to induce autophagy [8]. The delay in cell proliferation without leading to severe cell death has been observed in clinical trials with 2DG [9]. Since 2DG inhibits glycolysis and nucleotide production, sensitivity to drugs and radiation could be induced [10]. 3AB resembles NAD+ in structure and inhibits poly ADP-ribose (PAR) polymerase (PARP) [11],[12], which localizes both in nuclei and mitochondria, playing essential roles in DNA repair, maintenance of the chromatin and cell survival. In the presence of DNA strand breaks, PARP binds to the breakage sites to synthesize PAR, consuming an NAD+ as a substrate [13]. In normal cells, a homologous recombination system will help cells to survive. However, in cancerous cells that have BRCA1 or BRCA2 mutations, PARP inhibitors (PARPi) effectively induce cell death [14]. The first approved PARP inhibitor, OLA, induces autophagy and mitophagy in BRCA mutated ovarian and breast cancers to suppress proliferation [15]. PARPi are expected to reduce consumption of NAD+ in PARP-activated cells.
In this study, the bidirectional promoters of the human mitochondrial function-associated genes were amplified by polymerase chain reaction (PCR). They were ligated into the multi-cloning site (MCS) of the Luc reporter plasmid pGL4.10[luc2]. Multiple transfection [16] and Luc assays in HeLa S3 cells showed that the IDH1 promoter positively responded to all four NAD+-affecting drugs. Quantitative RT-PCR and Western blotting showed that both gene and protein expressions of the IDH1 were induced. Deletion and point mutation experiments narrowed the drug responsive region, containing duplicated GGAA and the GC-box. These findings suggested that up-regulation of NAD+/NADH induces IDH1 to accelerate conversion of citrate to α-ketoglutarate, which could then be imported into mitochondria, assisting progression of the TCA cycle.
2.
Materials and methods
2.1. Materials
Four compounds were tested if they could affect promoter activities. trans-Resveratrol (Rsv) (Cat. No. CAS501-36-0) [17] was purchased from Cayman Chemical (Ann Arbor, MI), and 2-deoxy-D-glucose (2DG) and 3-aminobenzamide (3AB) were purchased from WAKO Pure Chemical (Tokyo, Japan). Olaparib (OLA) was from ChemScene, LLC (Monmouth Junction, NJ). Rsv is known to upregulate mitochondrial complex I, which oxidizes NADH to produce NAD+ [18]. 2DG has been also reported to increase cellular NAD+/NADH level [19]. 3AB and OLA are well known as PARP inhibitors [15],[20]. It has been reported that NAD+/NADH level in HeLa S3 cells could be upregulated by 8 h treatment of Rsv (20 µM), 2DG (8 mM), 3AB (5 mM), OLA (2.5 µM) [3].
2.2. Cells and cell culture
Human cervical carcinoma (HeLa S3) cells [16] were grown in Dulbecco's modified Eagle's medium (DMEM) (FUJIFILM Wako Pure Chemical, Osaka, Japan), supplemented with 10% fetal bovine serum (FBS) (Biosera, East Sussex, UK) and penicillin-streptomycin at 37 °C in a humidified atmosphere with 5% CO2.
2.3. Construction of Luciferase (Luc) reporter plasmids
Various Luc reporter plasmids, carrying approximately 500 bp, which contain both transcription start sites (TSSs) of the human bidirectionally transcribed gene pairs (Figure 1), were constructed by a slight modification of the procedure that has previously been described [17],[21].
Briefly, PCR was performed with sense/antisense primer-pair (Table 1) and genomic DNAs, which were extracted from HeLa S3 cells. The amplified DNA fragments, containing 466, 494, 306, 732, 369, 414 374, 425, 596 and 345 bp of the human ACRY/TTC25, ACO2/PHF5A, ATP5C1/KIN, CDK2/PMEL, COX15/CUTC, IDH1/IDH-AS1, MRPL32/PMSA2, MRPL37/SYB5RL, MRPS327/PTCD2 and MRPS30/MRPS30-DT bidirectional promoter regions, were treated with appropriate restriction enzyme(s). Then, they were ligated into the multi-cloning site (MCS) of pGL4.10[luc2] (Promega, Madison, WI). Resultant plasmids, containing the correct/(reverse) orientations, were named, as indicated in Table 1 and Figure 2.
Similarly, the IDH1 promoter deletion-introduced plasmids were constructed by ligating a PCR-amplified DNA fragment into the MCS of pGL4.10[luc2]. pGL4-IDH1-414 has an identical region in the pGL4-IDH1, but the 5′-end of the inserted DNA has been designed to have a KpnI site. The sense and anti-sense primers used for the amplification of the DNA fragments are shown in Table 2. The shaded nucleotides (Table 2) indicate the introduced mutations. PCR was performed with template pGL4-IDH1-WT and sense/antisense primer pairs, hIDH15180/AhIDH1-5084MM, hIDH15180M/AhIDH1-5084 and hIDH15180M/AhIDH1-5084MM (Table 2), to amplify mutation-introduced fragments, which were inserted into the MCS of pGL4.10[luc2] to make pGL4-IDH1-mut1, -mut2 and -mut3, respectively. The introduction of mutations in the pGL4-IDH1-mut4 and -mut5 was carried out according to a previously reported procedure [17] with slight modifications. Briefly, a PCR was carried out with sense hIDH1-mt/AhIDH1-mt primer pairs (Table 2) and pGL4-IDH1-mut1 as a template. The PCR products were denatured at 65 °C for 20 min, gradually cooled down to 25 °C for 20 min and further kept at 25 °C for 20 min. They were treated with T4 DNA polymerase (Toyobo, Osaka, Japan) and digested with KpnI and XhoI, which were ligated into the MCS of the pGL4.10[luc2]. The pGL4-IDH1-mut5 was obtained by the same procedure using pGL4-IDH1-mut4 as a template for PCR. Nucleotide sequences were confirmed by a DNA sequencing service (FASMAC, Greiner Japan Inc., Atsugi, Japan) with primers Rv (TAGCAAAATAGGCTGTCCCC) and GL (CTTTATGTTTTTGGCGTCTTCC). The Luc reporter plasmids, pGL4-PIF1, were constructed as described [22].
2.4. Transient transfection and Luc assay
Luc reporter plasmids were transfected into HeLa S3 cells by DEAE-dextran method in 96-well plates [16], and after 24 h of transfection, the culture medium was changed to Rsv (20 µM), 2DG (8 mM), 3AB (5 mM) or OLA (2.5 µM) containing DMEM with 10% FBS. After a further 24 h of incubation, cells were collected and lysed with 100 µL of 1 × cell culture lysis reagent, containing 25 mM Tris-phosphate (pH 7.8), 2 mM DTT, 2 mM 1,2-diaminocyclohexane-N,N,N′,N′,-tetraacetic acid, 10% glycerol and 1% Triton X-100. They were mixed and centrifuged at 12,000 × g for 5 sec. The supernatant was stored at −80 °C. The Luc assay was performed with a Luciferase assay system (Promega), and relative Luc activities were calculated as described previously [16],[17],[21],[22]. Because the human PIF promoter (590 bp) [22], which is contained in the pGL4-PIF1, is not affected by all chemicals used, results were compared with the pGL4-PIF1-transfected cells after both control/chemicals addition.
2.5. Western blot analysis
Western blot analysis was carried out after SDS-PAGE (15% acrylamide) as previously described [17],[21], with antibodies against IDH1 (Cat. No. sc-49996, Santa Cruz Biotechnology, Santa Cruz, CA) and β-actin (Cat. No. A5441, Sigma-Aldrich, St Louis, MO) followed by the addition of horseradish peroxidase (HRP)-conjugated anti goat (Cat. No. HAF109, Bio-techne, Minneapolis, MN) or anti-mouse IgG (Cat. No. A9917, Sigma-Aldrich, St Louis, MO) secondary antibodies. Signal intensities were quantified with a ChemiDoc and Image Lab system (Bio-Rad, Berkeley, CA).
2.6. Quantitative real-time reverse transcriptase polymerase chain reaction (RT-qPCR)
First-strand cDNAs were synthesized with ReverTra Ace (Toyobo, Tokyo, Japan), random primers (Takara) and total RNAs extracted from HeLa S3 cells. Real time PCR analysis was carried out using the Mx3000P Real-Time qPCR System (Stratagene, La Jolla, CA) [17],[21]. For PCR amplification, cDNAs were amplified by Thunderbird Realtime PCR Master Mix (Toyobo) and 0.3 µM of each primer pair. The primer pairs for amplifying human IDH1 and GAPDH transcripts were IDH1_h1104 GCATAGGCTCATCGACGACA/IDH1_Ah1236 CATCATGCCGAGAGAGCCAT and hGAPDH556/hGAPDH642 [17],[21],[22], respectively. Amplification was carried out initially for 1 min at 95 °C, followed by 40 cycles (95 °C 15 sec and 58 °C 30 sec). Quantitative PCR analysis for each sample was carried out in triplicates. Relative gene expression values were obtained by normalizing CT (threshold cycle) values of target genes in comparison with CT values of the GAPDH gene using the ΔΔCq method [23].
2.7. Statistical analysis
Standard deviations (S.D.) for each data were calculated and results are shown as means ± S.D. from three independent experiments. Statistical analysis for data in Figures 2, 3, and 7 was performed with the Student t-test, and asterisks indicate values of *p < 0.05, **p < 0.01 and ***p < 0.001.
3.
Results
3.1. Confirmation of bidirectional promoters that contain mitochondrial function associated gene transcription start sites by comparison of NCBI database
Duplicated GGAA motifs are frequently found within 500 bp from the putative TSSs of mitochondrial function associating protein-encoding genes [24]. To examine whether they respond to NAD+/NADH ratio-upregulating drugs [3], we cloned 306 to 732 bp of the 5′ upstream regions of the ACO2, ACLY, IDH1, ATP5C1, COX15, CDK2, MRPL32, MRPL37, MRPS27 and MRPS30 genes (Figure 1). As indicated, these genes are head-head linked with other genes or TSSs of non-coding RNAs. The JASPAR database indicated that most of them contained duplicated GGAA (TTCC) motifs.
The IDH1 promoter responded to Rsv, 2DG, 3AB and OLA (Figure 2A–D, respectively), which are known to induce cellular NAD+/NADH level after 8 h treatment of HeLa S3 cells [3]. The enzymes IDH3B, IDH3G, ACO2, CS and FH catalyzed reactions of the TCA cycle [25]–[27]. The duplicated GGAA (TTCC) motifs are contained in the cloned 5′-upstream regions of the IDH3B, ACO2, CS and FH genes (Figure 3). Similar experiments showed that IDH3B, IDH3G, ACO2, CS and FH promoters respond to 2DG and other drugs (Figures 2 and 3). Among them, only the IDH1 promoter showed positive responses to all drugs tested. Therefore, we focused on the regulation system of the IDH1 gene expression in HeLa S3 cells. Sequence analysis revealed that the PCR-amplified 414 bp of the pGL4-IDH1-414 contains a nucleotide identical to NCBI Sequence ID NC_000002.12 (nucleotide from 208255334 to 208254921) and that it covers the sequence of the most-upstream 5′- end of the IDH1 cDNA (Sequence ID NM_005896.3 and GENE ID 3417) having no mutations. This 414 bp contains a 5′-upstream end of a non-coding RNA (ncRNA) IDH1-AS1 (Sequence ID NR_046452.1 and GENE ID 100507475) in a reverse orientation to that of the IDH1 gene. The TSS was tentatively set as +1 at the most upstream 5′ of the IDH1 transcripts shown in the database. The JASPAR database (http://jaspar.genereg.net/) suggested several known transcription factor recognition sequences (Figure 4). Although no obvious TATA or CCAAT boxes were found, putative binding sites for E2F1 (-158 to -148), ETS1 (+43 to +48), GATA2 (-61 to -57, +195 to +199), KLF5 (-20 to -11, -87 to -78, +20 to +29), KLF14 (-88 to -75), KLF16 (-21 to -11, -87 to -77), MZF1 (-153 to -138, -9 to -4), NFIC (-48 to -43, +128 to +133), NFIX (+126 to +134), RHOXF1 (-134 to -127), SOX10 (+29 to +34), SP1 (-21 to -11, +8 to +18), SP2 (+4 to +18), SP3 (-87 to -77, -21 to -11), SPI1 (-145 to -140, +37 to +42) and SPIB (+41 to +47) are contained.
3.2. Effects of Rsv on IDH1 gene expression and its protein amount in HeLa S3 cells
First, total RNAs were extracted from cells after adding Rsv (20 µM) to the culture medium. The relative gene expression IDH1/GAPDH began to increase from 1 h after Rsv addition and reached a transient peak at 2 h, and then it declined and gradually increased to 2-fold at 24 h (Figure 5).
3AB (5 mM) treatment also induced relative IDH1 gene expression after 1 to 2 h addition to the culture medium (Figure 5). Similar early response was observed by 2DG (8 mM) treatment. However, the effect was most eminent at 24 h after the treatment. Surprisingly, OLA (2.5 µM) did not affect the IDH1 gene expression during 24 h treatment. The results suggested that 2DG and OLA evoked some signals that regulate IDH1 transcripts degradation or splicing. The observations, indicating that Rsv and 3AB increased IDH1 transcripts effectively early after the treatment, lead us to further analyze IDH1 protein amount. However, Western blot analysis revealed that the amount of IDH1 protein did not change significantly during treatment with Rsv and 3AB. The IDH1/β-actin ratio was reduced to 85% of the control after 2 h, but it increased to the control level at 4 h after Rsv treatment, and then it declined and increased again to the control level (Figure 6). The IDH1/β-actin ratio did not change during 3AB treatment (Figure 6). The results suggest that the amount of IDH1 protein is restricted or post-transcriptionally maintained at a stable level through two mechanisms: degradation of IDH1 protein and regulation by non-coding or micro RNAs with regulatory functions.
3.3. Identification of a drug responsive element in the IDH1 promoter
To narrow the drug responsive sequence(s), deletion was introduced in the pGL4-IDH1-414 plasmid vector (Figure 7A). Positive responses to 2DG, 3AB and OLA were observed in pGL4-IDH1-Δ1 and -Δ2-transfected cells. However, pGL4-IDH1-Δ3-transfected cells showed a much-lowered response to Rsv compared to the pGL4-IDH1-Δ2-transfected cells (Figure 7A).
The pGL4-IDH1-Δ8-transfected cells showed apparent responses to all drugs (Figure 7B), but this was not observed in pGL4-IDH1-Δ9 transfected cells, suggesting the 35 bp containing the putative c-ETS binding sequence and a GC-box are of primary importance for IDH1 promoter activity. This was confirmed by further deletion experiments, showing that a 154 bp sequence from -41 to +113 is a core promoter region with drug responsiveness (Figure 7C). This core promoter sequence is thought to be conserved within mammals, because the BLAST search program indicated that upstream sequence 153 bp region of the mouse Idh1 gene transcript variant 2 (in NC_000067.7) has 71% homology with the 154 bp (in NC_000002.12) (supplementary Figure 1). To precisely indicate the drug responsive element(s), point mutations were introduced to the pGL4-IDH1-WT that carries the 154 bp (Figure 7D). Mutations on a GC-box (in pGL4-IDH1-mut2) greatly reduced basal promoter activity and the response to the drugs. The pGL4-IDH1-mut1-transfected cells showed higher promoter activity than pGL4-IDH1-WT transfected cells, suggesting that the duplicated GGAA functions as a suppressor or a modulator. The positive responses to drugs were completely lost by a mutation on the GC-box in the pGL4-IDH1-mut4 and -mut5 (Figure 7D). These results suggested that the IDH1 promoter is co-operatively regulated by the c-ETS element and a GC-box to respond to NAD+ up-regulating drugs in HeLa S3 cells.
4.
Discussion
Many interferon-stimulated genes (ISGs) [28] and DNA repair-factor encoding genes [29] are TATA-less [30]. The human E2F4 [21] and ZNFX1 [31] promoters are also TATA-less, containing duplicated GGAA-motifs to respond to TPA, which induces macrophage-like differentiation of HL-60 cells. Moreover, duplicated GGAAs are contained in the human TP53 [17], HELB [32] and MCM4 [33] and a variety of mitochondrial function-associated gene promoters [29]. The ACLY, ACO2, IDH1 and ATP5C1 encode enzymes that regulate or affect the TCA cycle [34] or OXPHOS [35]. The MRPL32/37, MRPS27/30 and PTCD2 genes encode mitochondrial ribosomal protein subunits [36] and a regulator that processes the RNA of cytochrome b [37]. All tested promoters containing duplicated GGAAs responded to 8 mM of 2DG (Figure 2), which limits glucose uptake and hexokinase activity [38] and up-regulates NAD+/NADH ratio in HeLa S3 cells [19]. Rsv activates mitochondrial complex I in the respiratory system [18]. 3AB and OLA will increase NAD+ by inhibiting PARP that consumes NAD+ for PAR synthesis [12]. Generally, in cancerous cells, energy production primarily depends on glycolysis [39]. Lowered NAD+/NADH ratio, during aging and cancer development [40], may cause both the Warburg effect and mitochondrial dysfunction. In this study, it was strongly suggested that the IDH1 promoter contains NAD+/NADH sensitive element(s). However, the protein amount of IDH1 should be tightly regulated (Figure 6) by post-transcriptional mechanisms, which should be elucidated. It has been reported that miR-181a in mouse [41] and miR-32/-92b in human breast cancer [42] reduce IDH1. In addition, miR-101 and miR-183 could suppress IDH2 in human cancer [43],[44]. Although expression of micro RNAs in HeLa S3 cells has not been examined, they could target IDH1 and IDH2. Generally, the upregulation of the NAD+/NADH ratio is thought to be beneficial for cancer prevention and anti-aging. Anyhow, the results all suggest that if an NAD+/NADH increasing event happens, post-transcriptional regulation will prevent aberrant increase of IDH1, which could be involved in fatty acid metabolism [45].
SP1, SP3, KLF5 and KLF16 bind to GC-box [46], which is present adjacent to the putative TSS of the IDH1 gene (Figure 4). The Sp1 and KLF5 induce HIF-1 gene expression [47]–[49]. In this study, it was shown that the GC-box is essential for the drug response, and a duplicated GGAA motif acts as a suppressor (Figure 7D). ETS family proteins and NF-κB, which bind to duplicated GGAA containing sequences [50], might hinder other TFs' action. Given that CtBP regulates mitochondrial function [51],[52] by binding to SPI1 and NF-κB [53],[54], it can regulate NAD+-dependent transcription.
In cancer, NAD+ would be consumed by PARP when DNA damage occurs. In gliomas and glioblastomas, increased cellular NAD+, which causes high IDH1 expression [55], may increase NADPH that activates hypoxia-inducible factor-1 (HIF-1) to promote hypoxia [48],[56]. Under such circumstances, both lipid biosynthesis and hypoxia will be overpromoted to disturb the oxidation/reduction balance, forcing cells into a malignant state [57]. NAD+, which is reduced in accordance with aging [40], is an essential co-enzyme for the TCA cycle and OXPHOS and suppresses carcinogenesis [57],[58]. It should be noted that IDH1 plays a role in epigenetic regulation [59] and that its gene promoter is bidirectional, linked with IDH1-AS1 in a head-head manner. In contrast, promoters of the DNMT1, DNMT3A, DNMT3B and DNMT3L genes, which encode DNA methyl transferases, are unidirectional to be isolated from other gene TSSs. NAD+ dependent deacetylase SIRT1 prevents DNA methylation in murine embryonic stem cells [60]. To establish a novel mitochondrial metabolism targeting [61],[62] anti-cancer gene therapy [63], the NAD+ dependent transcriptional and post-transcriptional systems should be elucidated.
Use of AI tools declaration
The authors declare they have not used Artificial Intelligence (AI) tools in the creation of this article.
DownLoad:
