Research article Topical Sections

Changes in nucleosome formation at gene promoters in the archiascomycetous yeast Saitoella complicata

  • We measured the degree of nucleosome formation at the gene promoters in trichostatin A-treated (1, 2, and 3 μg/mL) cells of the archiascomycete Saitoella complicata and those in enlarged S. complicata cells after zymolyase treatment. TSA-treated and enlarged cells showed similar changes in nucleosome occupancy in five out of six positions in the gene promoters. These results suggest that changes in nucleosome formation at the gene promoters could serve as stress response mechanisms elicited in response to spheroplast (zymolyase treatment) and TSA treatment. In addition, we demonstrated that changes in nucleosome position occurred mainly in cells treated with 1 μg/mL TSA, whereas cells treated with 2 and 3 μg/mL TSA did not exhibit significant changes in the degree of nucleosome formation.

    Citation: Hikaru Nakamiya, Saeka Ijima, Hiromi Nishida. Changes in nucleosome formation at gene promoters in the archiascomycetous yeast Saitoella complicata[J]. AIMS Microbiology, 2017, 3(2): 136-142. doi: 10.3934/microbiol.2017.2.136

    Related Papers:

    [1] Kenta Yamauchi, Shinji Kondo, Makiko Hamamoto, Yutaka Suzuki, Hiromi Nishida . Genome-wide maps of nucleosomes of the trichostatin A treated and untreated archiascomycetous yeast Saitoella complicata. AIMS Microbiology, 2016, 2(1): 69-91. doi: 10.3934/microbiol.2016.1.69
    [2] Sawako Takahashi, Ayana Takayanagi, Yurika Takahashi, Taku Oshima, Hiromi Nishida . Comparison of transcriptomes of enlarged spheroplasts of Erythrobacter litoralis and Lelliottia amnigena. AIMS Microbiology, 2016, 2(2): 152-189. doi: 10.3934/microbiol.2016.2.152
    [3] Mojtaba Moosavian, Mina Moradzadeh, Ataollah Ghadiri, Morteza Saki . Isolation and Identification of Legionella spp. in environmental water sources based on macrophage infectivity potentiator (mip) gene sequencing in southwest Iran. AIMS Microbiology, 2019, 5(3): 223-231. doi: 10.3934/microbiol.2019.3.223
    [4] Satoshi Kami, Rintaro Tsuchikado, Hiromi Nishida . DNA replication and cell enlargement of Enterococcus faecalis protoplasts. AIMS Microbiology, 2019, 5(4): 347-357. doi: 10.3934/microbiol.2019.4.347
    [5] Yusuke Morita, Mai Okumura, Issay Narumi, Hiromi Nishida . Sensitivity of Deinococcus grandis rodZ deletion mutant to calcium ions results in enhanced spheroplast size. AIMS Microbiology, 2019, 5(2): 176-185. doi: 10.3934/microbiol.2019.2.176
    [6] Zoya Samoilova, Alexey Tyulenev, Nadezhda Muzyka, Galina Smirnova, Oleg Oktyabrsky . Tannic and gallic acids alter redox-parameters of the medium and modulate biofilm formation. AIMS Microbiology, 2019, 5(4): 379-392. doi: 10.3934/microbiol.2019.4.379
    [7] Risa Ago, Daisuke Shiomi . RodZ: a key-player in cell elongation and cell division in Escherichia coli. AIMS Microbiology, 2019, 5(4): 358-367. doi: 10.3934/microbiol.2019.4.358
    [8] Natalia Y. Kovalskaya, Eleanor E. Herndon, Juli A. Foster-Frey, David M. Donovan, Rosemarie W. Hammond . Antimicrobial activity of bacteriophage derived triple fusion protein against Staphylococcus aureus. AIMS Microbiology, 2019, 5(2): 158-175. doi: 10.3934/microbiol.2019.2.158
    [9] Luciana C. Gomes, Filipe J. Mergulhão . Effect of heterologous protein expression on Escherichia coli biofilm formation and biocide susceptibility. AIMS Microbiology, 2016, 2(4): 434-446. doi: 10.3934/microbiol.2016.4.434
    [10] Amira Saied M Abdelhady, Nebal Medhat Darwish, Safaa M. Abdel-Rahman, Nagwa M Abo El Magd . The combined antimicrobial activity of citrus honey and fosfomycin on multidrug resistant Pseudomonas aeruginosa isolates. AIMS Microbiology, 2020, 6(2): 162-175. doi: 10.3934/microbiol.2020011
  • We measured the degree of nucleosome formation at the gene promoters in trichostatin A-treated (1, 2, and 3 μg/mL) cells of the archiascomycete Saitoella complicata and those in enlarged S. complicata cells after zymolyase treatment. TSA-treated and enlarged cells showed similar changes in nucleosome occupancy in five out of six positions in the gene promoters. These results suggest that changes in nucleosome formation at the gene promoters could serve as stress response mechanisms elicited in response to spheroplast (zymolyase treatment) and TSA treatment. In addition, we demonstrated that changes in nucleosome position occurred mainly in cells treated with 1 μg/mL TSA, whereas cells treated with 2 and 3 μg/mL TSA did not exhibit significant changes in the degree of nucleosome formation.


    1. Introduction

    Nucleosomes contain histone octamers around which DNA is wrapped [1]. Neighboring nucleosomes are separated by unwrapped linker DNA. Generally, a nucleosome's position with respect to the gene promoter plays an important role in yeast gene expression [2,3,4,5]. Nucleosome arrangement is also specific to an organism [6].

    Trichostatin A (TSA) is a histone deacetylase inhibitor that promotes histone acetylation, which induces hyperacetylation of histones [7]. TSA influences nucleosome structure via histone acetylation. In addition, TSA influences nucleosome positions in the filamentous ascomycete Aspergillus fumigatus [8]. The acetylation and deacetylation of histones play an important role in the regulation of transcription [9]. Our previous study showed that TSA influences gene expression and nucleosome position in the archiascomycete Saitoella complicata [10]. Our study identified a total of 154 genes upregulated in a concentration-dependent manner in response to TSA treatment, whereas 131 genes were identified to be increasingly downregulated with increasing TSA concentration [10]. Most of nucleosome positions did not change after TSA treatment [10]. The anamorphic and saprobic budding yeast S. complicata, which is classified under Taphrinomycotina, represents the earliest ascomycetous lineage [11,12]. The fission yeast Schizosaccharomyces is also classified under Taphrinomycotina [12].

    In the previous study, we compared the nucleosome positions in 0 and 3 μg/mL TSA [10]. Thus, it was uncertain whether nucleosome position changed in a TSA concentration-dependent manner or not. If nucleosome position did not change in a TSA concentration-dependent manner, at which concentration did the position change? In this study, we investigated whether genes that are known to be regulated in response to TSA treatment also exhibit changes in nucleosome formation at the gene promoters in a TSA concentration-dependent manner.

    In addition, the ascomycetous yeast Saccharomyces cerevisiae spheroplast was reported to enlarge using zymolyase [13,14]. Enlarged spheroplast cells contain multiple nuclei [13]. It was uncertain how the multiple nuclei were maintained. Do nucleosome positions differ in between single nucleus and multiple nuclei? In bacterial enlarged spheroplasts, DNA was replicated and stress response genes were upregulated [15]. We found that S. complicata cells enlarge when grown in minimal SD broth (Takara, Japan) after zymolyase treatment. Thus, we measured the extent of nucleosome formation at the gene promoters in enlarged S. complicatacells and compared them with nucleosome formation levels in TSA-treated cells.


    2. Materials and Method


    2.1. Saitoella complicata culture

    Saitoella complicata NBRC 10748 (= JCM 7358, = IAM 12963; type strain) was cultivated in YM broth (yeast extract, 3 g/L; malt extract, 3 g/L; peptone, 5 g/L; dextrose, 10 g/L) at 25 ℃ for 24 h as a control sample. Afterwards, TSA (1, 2, and 3 μg/mL) was added to the S. complicata culture; cells were subsequently incubated at 25 ℃ for 24 h. For the enlarged spheroplast generation, S. complicata was grown in minimal SD broth (Takara, Japan) at 25 ℃ for 30 h. Harvested cells were centrifuged for 5 min at 3000 rpm and suspended in buffer containing 0.8 M sorbitol and 25 mM phosphate at 25 ℃ for 20 min. Zymolyase 20T (Seikagaku corporation, Japan) was added to the cell suspension; the cells were incubated at 37 ℃ for 60 min. S. complicata cells were harvested, centrifuged for 5 min at 3000 rpm, and cultured in minimal SD broth (adjusted to pH 7.5) at 25 ℃ for 4-7 days.


    2.2. Nucleosomal DNA fragment isolation

    Equal volumes of S. complicata culture and 2% formaldehyde were mixed and incubated for 10 min. Next, 5 mL of 1.25 M glycine was added to the resulting solution. S. complicata cells were collected, washed with 50 mM Tris-EDTA buffer (pH 8), and then suspended in zymolyase buffer (1 M sorbitol, 10 mM DTT, and 50 mM Tris-HCl, pH 8.0). Zymolyase (Seikagaku corporation, Japan) (50 U) was added to the cell suspension, and the resulting solution was incubated at 37 ℃ for 1 h. Cells were collected by centrifugation and suspended in 2.5 mL of zymolyase buffer, after which 1 U of MNase (Takara, Japan) was added. The resulting digestion solution was incubated at 37 ℃ for 30 min, and the reaction was stopped by adding sodium dodecyl sulfate to a final concentration of 1% and EDTA to a final concentration of 10 mM. Proteinase K solution (5 μL) was added to the solution, and the mixture was incubated at 56 ℃ for 1 h. DNA was phenol/chloroform-extracted, ethanol-precipitated, and treated with RNase (Nippon Gene, Japan). Nucleosomal DNA fragments were isolated via electrophoresis on 2% agarose gel. The mononucleosomal DNA band was excised and purified using the QIAquick Gel Extraction Kit (Qiagen, Germany).


    2.3. Quantitative PCR

    In this study, we selected six nucleosome positions in the gene promoters (300 nucleotides upstream of the translational start site) of the following four locus tags: G7K_2351-t1, G7K_2810-t1, G7K_3456-t1, and G7K_5676-t1. G7K_2351-t1 and G7K_2810-t1 encode homologs to 19S proteasome regulatory subunit Rpn3 and 20S proteasome-component α6 subunit Pre5, respectively, and are known to be increasingly downregulated upon treatment with increasing concentrations of TSA [10]. G7K_3456-t1 encodes a homolog to anaphase promoting complex subunit Apc11, whereas the G7K_5676-t1 gene is not homologous to any Schizosaccharomyces pombe protein. G7K_3456-t1 and G7K_5676-t1 are genes that are both upregulated in response to TSA treatment in a concentration-dependent manner [10]. Table 1 and Supplementary Figure 1 list the primers used in this study. We selected the position 5676_0 as an internal control, which showed the same nucleosome formation level between the cells treated with 0 μg/mL and 3 μg/mL TSA (Supplementary Figure 1) [10]. PCR was performed using the following cycling conditions: 1 cycle of 95 ℃ for 600 s and 45 cycles of denaturation (95 ℃ for 10 s), annealing (55 ℃ for 10 s), and extension (72 ℃ for 15 s). After the extension, a melting curve cycle was performed from 60 ℃ to 95 ℃ at 0.1 ℃/s to confirm the absence of non-specific bands. The quantification cycle (Cq) values were obtained using LightCycler Nano Software (Roche, Basel). We calculated the nucleosome formation level using the following formula: 2(Cq value at the position 5676_0 − Cq value at each position).

    Table 1. Primers used in this study.
    Target position Forward (5' to 3') Reverse (5' to 3') Product size (bp)
    2351 ggcaggcagtccaatagagt gagatcaagaggggttcacg 103
    2810_1 gcagtttaacgacgagaaggtt cgcctcggtaataggtattcat 110
    2810_2 ggacaagctcctggtcttcc cccttcaaagcacctcaatc 110
    3456 gagaagctaaccgagcaacttt tggccaattgaacaaacgat 109
    5676_1 tcagcgattccccaagttat gatgagggcgtcgagttc 110
    5676_2 gttcacgaggacagatcagg ggagttcgaaccatctttataacttg 109
    5676_0 (control) gagcgggatgtctttgtgat ctaggcagtcactgggatcg 99
     | Show Table
    DownLoad: CSV
    Figure 1. Phase contrast micrographs of Saitoella complicata. (A) Normal budding cells in minimal SD broth before zymolyase treatment. (B) Enlarged spheroplasts after 112 h of culture in minimal SD broth after zymolyase treatment. Phase contrast microscopy images were obtained using Olympus CKX41; bar = 50 μm.

    We performed analysis of variance (ANOVA) and a pairwise t test with Holm's adjustment using R statistical software (http://www.r-project.org/).


    3. Results and Discussion

    The typical diameter of a Saitoella complicata cell is approximately 5 μm, whereas that of an enlarged spheroplast cultured in minimal SD broth after zymolyase treatment was measured to be approximately 15 μm (Figure 1).

    ANOVA results showed that nucleosome formation levels were not significantly (p > 0.05) different at position 2351 but significantly different (p < 0.05) at the five other positions, namely, 2810_1, 2810_2, 3456, 5676_1, and 5676_2 (Figure 2).

    Figure 2. Comparison of nucleosome formation levels. The degree of nucleosome formation at position 5676_0 (control) is 1. We calculated the degree of nucleosome formation using the following formula: 2(Cq value at the position 5676_0-Cq value at each position). Star indicates p < 0.05 in a pairwise t test with Holm's adjustment.

    Among the five positions, analysis using pairwise ttest with Holm's adjustment showed no significant differences in terms of the degree of nucleosome formation at position 5676_1 (p > 0.05) between normal budding cells (0 μg/mL TSA) and enlarged cells (culture in minimal SD broth). However, significant differences (p < 0.05) in nucleosome formation levels were observed in the four other positions (2810_1, 2810_2, 3456, and 5676_2) (Figure 2). In addition, no significant differences in nucleosome formation were observed between enlarged cells and TSA-treated cells (2 and 3 μg/mL) at positions 2810_1, 2810_2, and 5676_2 (Figure 2). The above results strongly suggest that TSA-treatment and culture in minimal SD broth after zymolyase treatment exert similar effects on nucleosome formation at positions 2810_1, 2810_2, and 5676_2. Further research is necessary to confirm whether enlarged cells exhibit different histone acetylation patterns. Changes in nucleosome formation at the gene promoters can represent a stress response mechanism in cells subjected to spheroplast (zymolyase treatment) and TSA treatment. On the other hand, the degree of nucleosome formation at position 5676_1 was observed to be significantly different between enlarged cells and TSA-treated cells (Figure 2). However, nucleosome formation at this position was not significantly different between normal budding cells and enlarged cells. Thus, the observed nucleosome formation at position 5676_1 is specific to TSA-treated cells.

    Changes in the degree of nucleosome formation appeared to occur in a TSA concentration-dependent manner at positions 3456 (decreasing) and 5676_1 (increasing) (Figure 2). However, no significant differences in nucleosome formation levels were observed between cells treated with 1 and 2 μg/mL TSA and between cells treated with 2 and 3 μg/mL TSA (Figure 2).

    Nucleosome formation at position 5676_1 increased after TSA-treatment (Figure 2). On the other hand, nucleosome formation levels decreased after TSA-treatment at the neighboring position 5676_2 (Figure 2), which strongly suggests that a histone octamer can move from position 5676_2 to 5676_1. Based on the calculated nucleosome formation levels and p values, cells treated with 1 μg/mL TSA evidently showed nucleosome movement (Figure 2). Interestingly, changes in nucleosome position did not occur in enlarged cells, since nucleosome formation was observed only at position 5676_2 (Figure 2).

    In positions 2810_1 and 2810_2 (neighboring regions), nucleosome formation levels decreased as a result of TSA-treatment (Figure 2). This suggests that two histone octamers may be absent at these two positions. The observed nucleosome depletion at position 2810_2 is inconsistent with the results of the previous study (Supplementary Figure 1) and suggests that the nucleosome occupancy at this position is unstable.

    Except for position 2351, nucleosome formation levels in all other positions were significantly different between cells treated with 0 and 1 μg/mL TSA. However, no significant differences were observed between cells treated with 2 and 3 μg/mL TSA. The above results indicate that changes in the nucleosome formation occurred mainly in cells treated with 1 μg/mL TSA but not in cells treated with 2 and 3 μg/mL TSA.


    4. Conclusion

    We demonstrated that although TSA-treatment and zymolyase-treatment are completely different stimulus, TSA-treated cells and enlarged spheroplasts ofSaitoella complicata showed similar changes in nucleosome formation in five out of six gene promoter positions examined in the present study. These results strongly suggest that changes in nucleosome formation could serve as a stress response mechanism of S. complicata cells. Different stressors (TSA and zymolyase treatments) induce similar changes in the patterns of nucleosome formation in gene promoters in S. complicata.


    Acknowledgments

    This work was supported by JSPS KAKENHI grant no. 25440188 and a grant from The Cannon Foundation.


    Conflict of Interest

    The authors declare that there is no conflict of interest regarding the publication of this paper.


    [1] Luger K, Mäder AW, Richmond RK, et al. (1997) Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 389: 251–260.
    [2] Yuan GC, Liu YJ, Dion MF, et al. (2005) Genome-scale identification of nucleosome positions in S. cerevisiae. Science 309: 626–630.
    [3] Tsankov AM, Thompson DA, Socha A, et al. (2010) The role of nucleosome positioning in the evolution of gene regulation. PLOS Biol 8: e1000414. doi: 10.1371/journal.pbio.1000414
    [4] Huebert DJ, Kuan PF, Keleş S, et al. (2012) Dynamic changes in nucleosome occupancy are not predictive of gene expression in dynamics but are linked to transcription and chromatin regulators. Mol Cell Biol 32: 1645–1653. doi: 10.1128/MCB.06170-11
    [5] Small EC, Xi L, Wang JP, et al. (2014) Single-cell nucleosome mapping reveals the molecular basis of gene expression heterogeneity. Proc Natl Acad Sci USA 111: E2462–E2471. doi: 10.1073/pnas.1400517111
    [6] Nishida H (2012) Conservation of nucleosome positions in duplicated and orthologous gene pairs. Scientific World J 2012: 298174.
    [7] Yoshida M, Horinouchi S, Beppu T (1995) Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function. Bioessays 17: 423–430. doi: 10.1002/bies.950170510
    [8] Nishida H, Motoyama T, Suzuki Y, et al. (2010) Genome-wide maps of mononucleosomes and dinucleosomes containing hyperacetylated histones of Aspergillus fumigatus. PLOS One 5: e9916. doi: 10.1371/journal.pone.0009916
    [9] Li B, Workman JL (2007) The role of chromatin during transcription. Cell 128: 707–719. doi: 10.1016/j.cell.2007.01.015
    [10] Yamauchi K, Kondo S, Hamamoto M, et al. (2016) Genome-wide maps of nucleosomes of the trichostatin A treated and untreated archiascomycetous yeast Saitoella complicata. AIMS Microbiol 2: 69–91. doi: 10.3934/microbiol.2016.1.69
    [11] Nishida H, Sugiyama J (1994) Archiascomycetes: detection of a major new linage within the Ascomycota. Mycoscience 35: 361–366. doi: 10.1007/BF02268506
    [12] Liu Y, Leigh JW, Brinkmann H, et al. (2009) Phylogenomic analyses support the monophyly of Taphrinomycotina, including Schizosaccharomyces fission yeasts. Mol Biol Evol 26: 27–34.
    [13] Yabe I, Horiuchi KI, Nakahara K, et al. (1999) Patch clamp studies on V-type ATPase of vacuolar membrane of haploid Saccharomyces cerevisiae. J Biol Chem 274: 34903–34910. doi: 10.1074/jbc.274.49.34903
    [14] Fukudomi T, Kotani T, Miyakawa I (2011) A simple method for culture and stable maintenance of giant spheroplasts from the yeast Saccharomyces cerevisiae. J Gen Appl Microbiol 57: 177–182. doi: 10.2323/jgam.57.177
    [15] Takahashi S, Takayanagi A, Takahashi Y, et al. (2016) Comparison of transcriptomes of enlarged spheroplasts of Erythrobacter litoralis and Lelliottia amnigena. AIMS Microbiol 2: 152–189. doi: 10.3934/microbiol.2016.2.152
  • Reader Comments
  • © 2017 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Metrics

Article views(4845) PDF downloads(767) Cited by(0)

Article outline

Figures and Tables

Figures(2)  /  Tables(1)

Other Articles By Authors

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return

Catalog