Research article Special Issues

Pre-service teachers' technology acceptance of artificial intelligence (AI) applications in education


  • Received: 11 June 2024 Revised: 16 September 2024 Accepted: 27 September 2024 Published: 09 October 2024
  • We verified a pre-service teachers' Extended Technology Acceptance Model (ETAM) for AI application use in education. Partial least squares structural equation modeling (PLS-SEM) examined data from 400 pre-service teachers in Central Visayas, Philippines. Perceived usefulness and attitudes, usefulness and attitudes, ease of use and attitudes, and intention to use AI apps were significantly correlated. However, subjective norms, experience, and voluntariness did not affect how valuable AI was viewed or intended to be used. Attitudes toward AI mediated specific correlations use. These findings improve the ETAM model and highlight the significance of user-friendly AI interfaces, educational activities highlighting AI's benefits, and institutional support to enhance pre-service teachers' adoption of AI applications in education. Despite its limitations, this study establishes the foundation for further research on AI adoption in educational settings.

    Citation: Isidro Max V. Alejandro, Joje Mar P. Sanchez, Gino G. Sumalinog, Janet A. Mananay, Charess E. Goles, Chery B. Fernandez. Pre-service teachers' technology acceptance of artificial intelligence (AI) applications in education[J]. STEM Education, 2024, 4(4): 445-465. doi: 10.3934/steme.2024024

    Related Papers:

    [1] Anastasiia D. Kurenkova, Peter S. Timashev . Mast cells: A dark horse in osteoarthritis treatment. AIMS Allergy and Immunology, 2022, 6(4): 228-247. doi: 10.3934/Allergy.2022017
    [2] Andrey Mamontov, Alexander Polevshchikov, Yulia Desheva . Mast cells in severe respiratory virus infections: insights for treatment and vaccine administration. AIMS Allergy and Immunology, 2023, 7(1): 1-23. doi: 10.3934/Allergy.2023001
    [3] Peter Jandus . Arachidonic acid metabolism and its use in the diagnosis of mastocytosis. AIMS Allergy and Immunology, 2023, 7(1): 82-91. doi: 10.3934/Allergy.2023006
    [4] Sammi Wong, Sara Hasan, Christina Parducci, Bernadette Ann Riley . The gastrointestinal effects amongst Ehlers-Danlos syndrome, mast cell activation syndrome and postural orthostatic tachycardia syndrome. AIMS Allergy and Immunology, 2022, 6(2): 19-24. doi: 10.3934/Allergy.2022004
    [5] Amolak S Bansal, Alex Nicholas, Nazira Sumar, Veronica Varney . Mast cells, mediators, and symptomatic activation. AIMS Allergy and Immunology, 2024, 8(1): 34-55. doi: 10.3934/Allergy.2024004
    [6] Haiyan Guo, Mingsheng Lei, Jinan Ma, Hongchun Du, Youming Zhang . Allergy and ferroptosis. AIMS Allergy and Immunology, 2025, 9(1): 8-26. doi: 10.3934/Allergy.2025002
    [7] Federica Serra, Lisa Aielli, Erica Costantini . The role of miRNAs in the inflammatory phase of skin wound healing. AIMS Allergy and Immunology, 2021, 5(4): 264-278. doi: 10.3934/Allergy.2021020
    [8] Masahiro Seike . Histamine suppresses T helper 17 responses mediated by transforming growth factor-β1 in murine chronic allergic contact dermatitis. AIMS Allergy and Immunology, 2018, 2(4): 180-189. doi: 10.3934/Allergy.2018.4.180
    [9] Omer Qibi, Severine Audusseau, Andrea Mogas, Zoulfia Allakhverdi, Abdelilah Soussi Gounni, Saba Al Heialy, Qutayba Hamid . No evidence for IgE receptor FcεRI expression on bronchial epithelial cells of asthmatic patients. AIMS Allergy and Immunology, 2018, 2(4): 165-179. doi: 10.3934/Allergy.2018.4.165
    [10] Ken S. Rosenthal, Daniel H. Zimmerman . J-LEAPS vaccines elicit antigen specific Th1 responses by promoting maturation of type 1 dendritic cells (DC1). AIMS Allergy and Immunology, 2017, 1(2): 89-100. doi: 10.3934/Allergy.2017.2.89
  • We verified a pre-service teachers' Extended Technology Acceptance Model (ETAM) for AI application use in education. Partial least squares structural equation modeling (PLS-SEM) examined data from 400 pre-service teachers in Central Visayas, Philippines. Perceived usefulness and attitudes, usefulness and attitudes, ease of use and attitudes, and intention to use AI apps were significantly correlated. However, subjective norms, experience, and voluntariness did not affect how valuable AI was viewed or intended to be used. Attitudes toward AI mediated specific correlations use. These findings improve the ETAM model and highlight the significance of user-friendly AI interfaces, educational activities highlighting AI's benefits, and institutional support to enhance pre-service teachers' adoption of AI applications in education. Despite its limitations, this study establishes the foundation for further research on AI adoption in educational settings.



    Atopic dermatitis (AD) affects nearly 31.6 million (10.1%) people in the United States [1] and of these, 18 million adults (7.2%) over the age of 18 have AD [2]. Gender disparities have been noted in the prevalence of AD with females being more prone during adulthood [3][12]. Data is lacking in males that supports mechanistic differences between the two sexes. Thus, many preclinical AD studies utilize female mice [13][14], with rare exceptions [14],[15].

    The pathophysiology of AD involves epidermal barrier dysfunction, a Th2/Th22 helper cell immune response and genetic polymorphisms which have a more uncertain role [16],[17]. Current therapies for AD are developed for lesional skin, although non-lesional skin is perturbed [17]. We previously reported pre-lesional skin remodeling and increased activation of mast cells (MC), skin-resident innate immune cells, via the signaling of a potently bioactive sphingolipid metabolite, sphingosine-1-phosphate (S1P), observed in female mice after 1 week of OVA treatment [18],[19]. This novel finding uncovered histologic and biochemical perturbations occurring in the skin before the development of any overt lesions. Here, we report pre-lesional skin responses in male mice upon a similar short 7-day epicutaneous exposure to OVA. We found that, conversely to female mice [18],[19], males did not exhibit any pre-lesional disease-inducing skin remodeling or MC activation. Importantly, samples from our previous report on female mice [18] and from the current report on male mice were collected and analyzed at the same time, following a gender-matched experimental design. While we did not ascertain the mechanism leading to the observed gender disparity, we established histological and biochemical differences in OVA-exposed male mouse skin compared to females that may partly elucidate the sex differences substantiated in adult AD prevalence.

    AD was induced in 8 to 12 weeks old male C57Bl/6J (WT) mice exactly as previously described and at the same time as the female mouse study [18],[20] (Charles River NCI, Frederick, MD, USA and The Jackson Laboratory Bar Harbor, ME, USA). Mouse randomization was performed using shuffled pieces of paper indicating treatment to assign mice to either experimental group. One by one centimeter square-sized gauze pad (“patch”) containing one hundred microliters of solution of either 100 µg OVA (Sigma-Aldrich, St Louis, MO, USA) or 0.9% saline vehicle only (saline control) was positioned on the shaved dorsal skin area after tape stripping. Patches were secured in position for seven days using a transparent dressing (Tegaderm, 3M HealthCare, St Paul, MN, USA) and bandages. Treated skin areas were harvested from euthanized mice. The AD model was validated as previously (our results [18] and [20]) through serum IgE level quantification in male mice that received three epicutaneous exposures, performed at the same time as in female mice. The full AD protocol consists in three rounds of one seven-day skin exposure via patch followed by fourteen days without patch. Circulating IgE levels were measured in sera from blood samples collected by cardiac puncture from euthanized mice and kept at −80 °C until use.

    All protocols were approved by the University of South Carolina Institutional Animal Care and Use Committee (Protocol 2403-101303-010818, “Mast cells and sphingosine-1-phosphate in allergic inflammation”). All experiments were performed in accordance with guidelines and regulations.

    Paraffin-embedded skin tissues were fixed with fresh paraformaldehyde (4%) and cut into 4 µm sections. Some sections were hematoxylin and eosin (H&E)-stained for morphometric analysis as previously described [18]. Others were stained with 0.1% methylene blue (MB) for 5 seconds, rinsed with water, dehydrated, and coverslip-mounted to locate MC and MC activation status [18],[21],[22]. All imaging and measurements were performed by blinded investigators. Imaging was performed at 10× and 40× magnifications using a Nikon E-600 microscope (Nikon Inc., Melville, NY) and a Micropublisher digital camera model 5.0. The QImaging software version 2.0.13 (QImaging Corp., Surrey, BC, Canada) was utilized for image analysis of 24-bit color or 8-bit monochrome images. The MetaMorph® 6.1 software (Molecular Devices, Sunnyvale, CA, USA) and the HarFa imaging software (www.fch.vutbr.cz/lectures/imagesci/) were employed to calculate morphometric and fractal parameters of nuclei allowing for infiltration quantification and measure MC status. Infiltration was measured in 25 to 30 ROIs per image using at least twelve 40× images per skin section and 4 skin sections per 2 mice from each treatment group. MC activation status (percent degranulation) was calculated in situ after analyzing fifty 40× images and 310 to 485 total MC present in 4 skin sections from 2 mice in each treatment group [18],[22].

    Epidermis, dermis, and hypodermis thickness was measured in saline- and OVA-treated samples with an ocular micrometer (Klarmann Rulings, Inc., Litchfield, NH, USA), exactly as described [18],[22]. The average thickness was calculated from 3 to 5 measurements (n = 3–5 mice per treatment group for each skin layer).

    We adapted our innovative imaging methods [22] to measure hypodermal cellular infiltration [18], using at least twelve high-magnification H&E images per individual mouse. First, the set-color-threshold subroutine (MetaMorph software) was used to isolate nuclei by color thresholding [18]. Next, the hypodermis in each section was surveyed using a fixed 75 µm diameter-sized region of interest (ROI) [18]. Thus, 25 to 30 ROIs were evaluated per skin section for a total of 2 sections per slide, using 2 slides for each individual mouse and 2 mice for each treatment group. Our previous work validated the morphometric parameters of area, perimeter, and integrated optical density (MetaMorph software's Integrated Morphometry Analysis subroutine) for accurate quantification of nuclei with elimination of nonspecific staining [18].

    After thresholding (Section 2.5), fractal dimensions (D) were measured after 8-bit grayscale image conversion exactly as previously described [18],[22].

    We established an imaging method to quantitatively described the cytoplasm of MC using fractal geometry [22], demonstrating that a fractal dimension (D) value of 1.378 ± 0.062 specifically designated intact/resting MC, whereas a D value of 1.484 ± 0.048 characterized degranulated/activated MC [22]. Here, we used these D values for nonsubjective measure of MC activation in male skin tissue samples (n = 2 to 5 mice per treatment group).

    Harvested skin tissue samples were immediately snap-frozen, and kept at −80 °C until use. Total RNA was extracted from 4 to 10 mice per treatment group using the miRNeasy kit (Qiagen, Valencia, CA, USA) and cDNA synthesized by reverse transcription (iScript cDNA synthesis kit, Bio-Rad, Hercules, CA, USA). A CFX Connect (Bio-Rad) was used to perform qPCR (duplicate determinations), using SensiFAST™ SYBR No-ROX Kit (Bioline, Taunton, MA, USA). We used the following primers (all purchased from Thermo Fisher Scientific, Inc., Waltham, MA, USA). for qPCR amplification: GAPDH forward primer CAGAAGGGGCGGAGATGAT and reverse primer AGGCCGGTGCTGCTGAGTATGTC, FcϵRIα forward primer ATTGTGAGTGCCACCGTTCA and reverse primer GCAGCCAATCTTGCGTTACA, CCL2 forward primer CACTCACCTGCTGCTACTCA and reverse primer GCTTGGTGACAAAAACTACAGC, CCL3 forward primer GCCATATGGAGCTGACACCC and reverse primer TAGTCAGGAAAATGACACCTGGC, and CCL5 forward primer TGCCCTCACCATCATCCTCACT and reverse primer GGCGGTTCCTTCGAGTGACA. We used the following qPCR conditions: initial step at 95 °C for 5 minutes and 40 cycles, as follows: 10 seconds at 95 °C, followed by annealing for 1 minute at 55 °C and extension for 1 minute at 72 °C. Data were analyzed with CFX Manager™ Software, after normalization to control (saline-treated) samples and to the amount of reference gene, GAPDH mRNA levels.

    CCL2, CCL3 and CCL5 chemokine quantifications were conducted in mouse serum and whole skin protein extracts prepared exactly as previously described [18], using a Bio-Plex Array Reader (LUMINEX 100; Bio-Rad Laboratories, Hercules, CA, USA) and Milliplex panels (EMD Millipore, Billerica, MA, USA). Whole skin protein extracts were weighed and immediately snap-frozen using liquid nitrogen. After homogenization with a mortar and pestle, skin samples were digested for 2 hours at 4 °C in reporter lysis buffer (Promega, Madison, WI, USA) supplemented with complete mini-protease inhibitors (Roche Diagnostics, Indianapolis, IN, USA). Supernatants were kept at −80 °C until use.

    Total IgE was quantified in mouse serum by ELISA (R&D Systems, Minneapolis, MN, USA). N = 6 and 9 mice per experimental group for 1 and 3 exposures, respectively.

    Lipids were extracted from snap-frozen skin tissues and S1P or sphingosine was quantified by liquid chromatography-electrospray ionization-tandem mass spectrometry (4000 QTRAP; AB Sciex, Foster City, CA, USA), as before [18], and normalized to skin sample weights. Saline and OVA solutions contained no detectable levels of S1P or sphingosine (data not shown). N = 3 to 4 samples per experimental group.

    Expressed as means ± SEM (unless otherwise indicated), data was analyzed using the unpaired 2-tailed Student's t-test, with Welch's correction for samples of unequal variance (Prism 6; GraphPad Software, La Jolla, CA, USA). Significance for all statistical tests is provided in figures. Each experiment was repeated at least 3 times in triplicate determinations with consistent results.

    We previously demonstrated that the epidermis and dermis were thickened in female mice after a single dose of OVA applied to the skin [18]. Moreover, there was an increase in cellular infiltration particularly around blood vessels (BV) [18]. Representative images of H&E-stained saline (Figure 1a) and OVA (Figure 1b) exposed male mice skins illustrate that no significant change was evidenced in epidermal, dermal or hypodermal thickness after 1 week of OVA treatment compared to controls (Figure 1c), in contrast to our reported findings in female mice collected at the same time [18]. We then measured cellular infiltration in the hypodermis by color thresholding the nuclei in the entire hypodermis of H&E-stained skin sections, exactly as previously described [18]. We report increased cellular infiltration in the hypodermis and around BV (Figure 1d–e) after OVA exposure of male dorsal skins, compared to saline controls. In order to independently confirm these results, we applied yet another of our previously published computerized imaging modalities to quantify cellular mass, a proxy for cell numbers/infiltration, by means of fractals, or space filling capacity [18],[22]. Cellular infiltration of the hypodermis (Figure 1d–e) was confirmed by an increase in cellular mass, expressed as augmented fractal dimension (D) values in the hypodermis and around BV (Figure 1f) after OVA treatment and compared to saline controls.

    Figure 1.  Skin remodeling quantitation in differentially treated male skin samples. Hypodermal cellular infiltration does not cause skin thickening after OVA exposure. Representative images of H&E-stained skin sections of (a) control (b) OVA treated mice. Original magnification 10× (scale bar = 50 µm). (c) Epidermal, dermal and hypodermal thickness. (d) Representative nuclei quantification in each region of interest across the hypodermis of one saline- (empty circles) and one OVA-treated (filled circles) mice, also distinguishing blood vessel (BV)-containing ROI (red symbols). (e) Quantification of cellular infiltration (nuclei per ROI) after saline (black symbols) or OVA (red symbols) skin treatment. (f) Validation of cell quantification by fractal dimension (D) of each ROI. N = 10–20 individual measurements collected from 3 to 5 mice per treatment group and per skin layer. ROI determinations: 25 to 30 ROI per image, at least 12 40×-images per skin section, 4 skin sections, 2 mice per treatment group.

    We previously reported that mRNA levels coding for FcϵRIα, the IgE-binding sub-unit of the high-affinity receptor for IgE reflected local MC numbers in this animal model of AD [18], yet were not significantly increased after OVA treatment, neither was MC degranulation (Figure 2b,d) compared to saline controls (Figure 2a,c) and in contrast to female mice [18].

    Figure 2.  Mast cell activation status in differentially treated male skin samples. OVA exposure does not cause skin MC activation after one OVA exposure in male mice. FcϵRIα (a) and percentage of degranulated MC (b) after OVA treatment (grey columns) compared to saline controls (black columns). Representative images of methylene blue-stained skin sections collected after saline (c) or OVA (d) exposure. Arrows indicate intact (red) and degranulated (yellow) MC, as detected by a validated computer-aided image analysis method. The insets represent magnifications of resting (red frame) or a degranulated (yellow frame) MC at 40×. Bar = 50 µm. Unpaired 2-tailed Student's t-test with Welch's correction. NS, not significant.

    As expected, the serum levels of IgE were not increased after one single OVA exposure but were increased after 3 OVA exposures (Figure 3a). Thus, we previously established that skin MC degranulation at this early stage of AD was not due to the classical IgE/Ag activation pathway but rather depended on S1P signaling in MC [18],[19]. Unaltered MC degranulation in male skin was concurrent to unchanged local levels of sphingolipid metabolites sphingosine (Figure 3b) and S1P (Figure 3c) and Sphk1 mRNA after OVA treatment compared to saline controls (Figure 3d), confirming the newly identified mechanistic insights we reported that pertained to AD onset [18],[19].

    Figure 3.  Circulating IgE levels, skin-associated sphingolipid sphingosine and S1P and SphK1 mRNA levels in differentially treated male skin samples. One OVA exposure does not elevate skin sphingosine or S1P levels, SphK1 mRNA expression or circulating IgE levels in male mice. (a) Serum IgE levels after 3 OVA or saline treatments. Skin levels of sphingosine (b), S1P (c) and SphK1 mRNA expression (d). Unpaired 2-tailed Student's t-test with Welch's correction. NS, not significant.

    The elevation of local cytokines/chemokines drives the development of AD, whereas their systemic augmentation correlates with disease progression and/or severity [17]. We previously demonstrated that airway [23] and skin [18] inflammatory responses were linked to local rather than systemic elevation of chemokines, thus demonstrating their pathogenic function in atopy. Whereas local levels of CCL2 (Figure 4a,b), CCL3 (Figure 4a,c) and CCL5 (Figure 4a,d) chemokines did not augment upon OVA skin treatment, circulating CCL2, CCL3 and CCL5 were significantly elevated in OVA-exposed male mice skin, compared to saline controls (Figure 4e).

    Figure 4.  Skin-associated versus circulating levels of chemokines in differentially treated male mice. Systemic but not local chemokines are elevated after one OVA exposure in male mice. (a) Skin CCL2, CCL3 and CCL5 mRNA expression. Skin protein levels of CCL2 (b), CCL3 (c) and CCL5 (d) and their circulating levels (e) in OVA- or saline-treated mice. Unpaired 2-tailed Student's t-test with Welch's correction. NS, not significant.

    Female mice are predominantly used in established preclinical models of AD that encompass epicutaneous applications of OVA [20], partly because they feature stronger antigen-dependent cutaneous inflammatory responses than males, similar to the female preponderance of AD observed in adolescent and adult humans [12],[24][26]. Although no single murine model fully recapitulates all dysregulated immune and barrier functions of human AD skin, OVA-challenged mice replicate activation of inflammatory pathways observed in patients with AD. Moreover, OVA as an AD-inducing agent can be used on different mouse backgrounds to account for genetic variability allowing to identify key players of cutaneous inflammation [14]. In gender-matched experiments, we noticed that male mice do not feature the same histopathological patterns seen in female mice. Pre-lesional skin changes occurring in males after one OVA exposure include hypodermal cell infiltration without epidermal or dermal thickening, suggesting a difference in the nature or the distribution of infiltrating cells between the two sexes. One limitation of our study is that we did not identify the cell types that were increased in the hypodermis. However, reports in mice identified eosinophils, MC and CD3+CD4+ cells [27] and human skin samples featured CD3+ T-cells and CD11c+ dendritic cells in non-lesional skin from patients with AD [28]. Skin changes occurring over time featured gradual chemokine increase, including CCL3 in female Balb/c mice after OVA treatment [27], in agreement with our data [18]. The paucity of reports analyzing the sequence of skin alterations at the onset of AD mouse models in males is noteworthy. Local CCL2, CCL3 and CCL5 mRNA and CCL2 and CCL3 protein levels were elevated in female mice [18] but not in male mice (our current study). These chemokines have been shown to induce recruitment of macrophages, granulocytes, CD3+ and CD4+ cells [23],[29]. Importantly, MC secrete these chemokines [30] and our group previously reported that S1P-mediated MC activation is essential to their local production in early allergic responses of the lung [23] and the skin [18]. In humans, data is mainly collected using skin samples from patients affected with moderate-to-severe AD, with overt skin lesions. Interestingly, many inflammatory chemokines, including CCL2, CCL3 and CCL5 are associated with human chronic, supporting leukocyte recruitment [31]. More recently, seminal studies focusing on the analysis of nonlesional skin specimens collected from patients with lesional AD, also demonstrated an increased inflammatory T cell infiltration, with elevated CCL5, CCL11, CCL17, CCL18 and CCL22 [28]. However, the authors acknowledged that their dataset does not reveal the key chemokines involved in primary pathogenesis of AD, which our studies are focusing on. Using immunohistochemistry, Su et al. established the chemokine profiles to study the evolution of T cell subsets in skin biopsies of 48 patients and their association with the progression of human AD from acute to chronic disease [32]. CCL5 was associated with sub-acute AD. Our current study established that male skin MC are not activated after a single OVA exposure, further supporting that MC activation does promote pre-lesional skin remodeling through local chemokine elevation. It has been postulated that increased local chemokine levels may result in systemic dissemination and elevated serum levels [33]. However, male mice did not display any elevation of local chemokines despite augmented serum levels. Brunner et al. suggested the occurrence of a mutual regulation with correlation of blood and skin markers in lesional and nonlesional human AD skin [34]. In this study, chemokines shared concomitant regulation between chronic lesional skin and serum in patients with moderate-to-severe AD. The authors found a strong systemic inflammation with elevated skin chemokine levels in this cohort of overweight patients, a plausible explanation for a pre-existing systemic inflammatory state. Because AD leads to systemic inflammation, Lauffer et al. proposed to use serum levels of chemokines, including CCL2, CCL3 and CCL5, as possible predictors of AD persistence in children [35]. However, no data was provided pertaining to skin-associated chemokine levels. Our data suggests that systemic detection of chemokines may perhaps mark resistance to AD development whereas local elevation may denote AD onset, susceptibility or a sign of active disease. Little is known about the dynamics of chemokine production in serum and in skin tissue or about the relative contributions of skin resident cells to inflammation development during the pre-lesional phase of AD, which both warrant further investigation.

    It is noteworthy that serum IgE levels are elevated in ~80% of patients with AD however, IgE levels do not necessarily correlate with disease severity [16]. In male mice, IgE levels were significantly elevated after 3 OVA patches, thus validating this AD model for both genders, although three skin exposures to OVA induced 2.5 times more serum IgE in female [18] compared to male mice (Figure 3a). Similar to our findings in female mice and as expected, a single OVA skin exposure did not suffice to elevate serum IgE levels in male mice (Figure 3a).

    Previous reports have demonstrated that epidermal thickening is observed in AD lesions with or without the presence of MC in filaggrin-deficient mice, rendering MC dispensable in this genetic model [36]. Notably, the disruption of the epidermal barrier due to filaggrin deficiency preceded any local MC activation in this model. It is tempting to speculate that MC may further perturb the skin barrier to enable AD. In contrast, other reports concluded that MC were protective to the epidermal barrier, also suggesting that MC mediators regulated skin barrier integrity [37]. However, the mouse gender was not revealed in their study where transgenic rather than allergen-induced AD models were employed, perhaps contributing to MC function discrepancies. Indeed, AD lesions feature neo-angiogenesis with MC-associated vascular endothelial growth factor-A (VEGF) [38]. In human AD lesions, epidermal thickening is observed, independently of MC localization to the epidermis [39]. In our current study, increased cellular infiltrate in the hypodermis and around BV was seen, as in female mice [18], but the absence of male skin remodeling was linked to lack of MC activation and of local CCL2, CCL3 and CCL5 mRNA and proteins.

    We previously identified a novel signaling pathway in MC by which SphK1-produced S1P from substrate sphingosine binds S1P receptor 2 (S1PR2) [23],[39][43], signaling through signal transducer and activator of transcription 3 to release CCL2, CCL3, CCL5, resulting in T-cell recruitment [23]. S1P/S1PR2 signaling in MC also triggered VEGF and matrix metalloproteinase 2 release, further pointing to an important role for MC in pre-lesional AD skin remodeling [44]. However, the MC/S1P axis was not disease inducing in male mice using the OVA-induced AD model, as skin levels of sphingosine, S1P or mRNA coding for SphK1 were not elevated. Moreover, MC degranulation was not augmented after OVA compared to control male mice, further supporting a critical role for S1P-mediated MC activation in pre-lesional AD skin remodeling, as observed in female mice. Nonetheless, OVA exposure did increase hypodermal cellular infiltration and systemic chemokine levels in male mice and three OVA exposures resulted in elevated serum IgE. Together, our results suggest that male mice may undergo an attenuated and/or delayed skin inflammation due to the absence of MC activation. Indeed, previous studies suggest that female sex hormones may exacerbate Th2 inflammation. Subcutaneous estradiol injection initiates allergic sensitization [45] and estradiol promotes in vitro MC degranulation [46],[47]. Anaphylactic responses are also more severe in female than male mice [48].

    There are potential limitations to this study. First, we are well aware that the mechanisms that underlie sex-related differences in skin disease and inflammation, while, mostly unknown, have not been addressed here. In addition to sex hormones as discussed above, genetic background and differences in skin barrier properties may also contribute to these differences. A better understanding of sex-related differences in skin inflammation may help better prevent, diagnose, and treat inflammatory skin diseases. Second, while we previously demonstrated an essential role for SphK1 in the upregulation of skin S1P levels after stimulation [18], SphK1 was similarly yet only assessed transcriptionally. Nonetheless, the unaltered levels of skin S1P after stimulation strongly supported an essential role for SphK1 in S1P elevation over any other isoform of SphK. Collectively, the current study demonstrates contrasted pathogenic mechanisms enabling skin inflammation in preclinical AD in male mice, compared to reports using female mice [18],[19].

    Clinical evidence had demonstrated that anti-IgE biologics do not affect the course of AD [16],[49], but may have therapeutic potential at high doses [50]. Thus, identifying S1P as a key MC stimulus of pre-lesional skin remodeling may be an important milestone in our understanding of factors that govern the transition from healthy to AD-prone skin. Estrogen exerts immunomodulatory functions on IgE-independent MC degranulation and chemokine production and higher susceptibility of human and mouse females to multiple sclerosis is due to higher production of S1PR2 compared to males [10], further supporting important inflammatory disease enabling functions of the MC/S1P axis.

    Our data suggests that S1P-mediated activation of MC is a critical event in early-stage AD, absent in male mice, perhaps relevant to higher prevalence of AD in females, supporting MC intervention to regulate the magnitude and/or perhaps time course [51] of inflammatory skin responses in a gender-dependent manner.



    [1] Bozkurt, A., Karadeniz, A., Baneres, D., Guerrero-Roldan, A.E. and Rodriguez, M.E., Artificial intelligence and reflections from educational landscape: A review of AI studies in half a century. Sustainability, 2021, 13(2): 800. https://doi.org/10.3390/su13020800 doi: 10.3390/su13020800
    [2] Chiu, T.K.F., Meng, H., Chai, C.S., King, I., Wong, S. and Yeung, Y., Creation and evaluation of a pre-tertiary Artificial Intelligence (AI) curriculum. IEEE Transactions on Education, 2021, 65(1): 30-39. https://doi.org/10.1109/TE.2021.3085878 doi: 10.1109/TE.2021.3085878
    [3] Holmes, W., Hui, Z., Miao, F. and Ronghuai, H., AI and education: A guidance for policymakers, 2021, UNESCO Publishing.
    [4] Alghamdi, A.A., Alanezi, M.A. and Khan, Z.F., Design and implementation of a computer aided intelligent examination system. International Journal of Emerging Technologoies in Learning, 2020, 15(1): 30-44. https://doi.org/10.3991/ijet.v15i01.11102 doi: 10.3991/ijet.v15i01.11102
    [5] Cao, J.J., Yang, T., Lai, I.K.W. and Wu, J., Student acceptance of intelligent tutoring systems during COVID-19: The effect of political influence. International Journal of Electrical Engineering Education, 2023, 60(1_suppl): 2495-2509. https://doi.org/10.1177/00207209211003270 doi: 10.1177/00207209211003270
    [6] Kong, J.S.M., Teo, B.S., Lee, Y.J., Pabba, A.B., Lee, E.J.D. and Sng, J.C.G., Virtual integrated patient: An AI supplementary tool for second-year medical students. Asia Pacific Scholar, 2021, 6(3): 87. https://doi.org/10.29060/TAPS.2021-6-3/SC2394 doi: 10.29060/TAPS.2021-6-3/SC2394
    [7] Aldosari, S.A.M., The future of higher education in the light of artificial intelligence transformations. International Journal of Higher Education, 2020, 9(3): 145-151. https://doi.org/10.5430/ijhe.v9n3p145 doi: 10.5430/ijhe.v9n3p145
    [8] Bellod, H.C., Ramón, V.B., Fernández, E.C. and Luján, J.F.G., Analysis of stress and academic-sports commitment through self-organizing artificial neural networks. Challenges, 2021, 42: 136-144. https://doi.org/10.47197/RETOS.V42I0.86983 doi: 10.47197/RETOS.V42I0.86983
    [9] Banerjee, M., Chiew, D., Patel, K.T., Johns, I., Chappell, D., Linton, N., et al., The impact of artificial intelligence on clinical education: Perceptions of postgraduate trainee doctors in London (UK) and recommendations for trainers. BMC Medical Education, 2021, 21: 1-10. https://doi.org/10.1186/s12909-021-02870-x doi: 10.1186/s12909-021-02870-x
    [10] Bates, T., Cobo, C., Mariño, O. and Wheeler, S., Can artificial intelligence transform higher education? International Journal of Educational Technology in Higher Education, 2020, 17: 1-12. https://doi.org/10.1186/s41239-020-00218-x doi: 10.1186/s41239-020-00218-x
    [11] Bonneton-Botte, N., Fleury, S., Girard, N., Le Magadou, M., Cherbonnier, A., Renault, M., et al., Can tablet apps support the learning of handwriting? An investigation of learning outcomes in kindergarten classroom. Computers & Education, 2020,151: 103831. https://doi.org/10.1016/j.compedu.2020.103831 doi: 10.1016/j.compedu.2020.103831
    [12] Bennane, A., Adaptive educational software by applying reinforcement learning. Informatics in Education-An International Journal, 2013, 12(1): 13–27.
    [13] González-Calatayud, V., Prendes-Espinosa, P. and Roig-Vila, R., Artificial intelligence for student assessment: A systematic review. Applied Sciences, 2021, 11(12): 5467. https://doi.org/10.3390/app11125467 doi: 10.3390/app11125467
    [14] Garg, S. and Sharma, S., Impact of artificial intelligence in special need education to promote inclusive pedagogy. International Journal of Information and Education Technology, 2020, 10(7): 523-527. https://doi.org/10.18178/ijiet.2020.10.7.1418 doi: 10.18178/ijiet.2020.10.7.1418
    [15] Kim, H.S., Kim, N.Y. and Cha, Y., Is it beneficial to use AI chatbots to improve learners' speaking performance? Journal of ASIA TEFL, 2021, 18(1): 161-178. https://doi.org/10.18823/asiatefl.2021.18.1.10.161 doi: 10.18823/asiatefl.2021.18.1.10.161
    [16] Luckin, R., Towards artificial intelligence-based assessment systems. Nature Human Behaviour, 2017, 1(3): 0028. https://doi.org/10.1038/s41562-016-0028 doi: 10.1038/s41562-016-0028
    [17] Haseski, H.I., What do Turkish pre-service teachers think about artificial intelligence? International Journal of Computer Sciences and Engineering Systems, 2019, 3(2): 3-23. https://doi.org/10.21585/ijcses.v3i2.55 doi: 10.21585/ijcses.v3i2.55
    [18] Hill, J., Randolph Ford, W. and Farreras, I.G., Real conversations with artificial intelligence: A comparison between human–human online conversations and human–chatbot conversations. Computers in Human Behavior, 2015, 49: 245-250. https://doi.org/10.1016/j.chb.2015.02.026 doi: 10.1016/j.chb.2015.02.026
    [19] Davis, F.D., Perceived usefulness, perceived ease of use, and user acceptance of information technology. MIS Quarterly, 1989,319-340. https://doi.org/10.2307/249008 doi: 10.2307/249008
    [20] Davis, F.D., Bagozzi, R.P. and Warshaw, P.R., Extrinsic and Intrinsic Motivation to Use Computers in the Workplace1. Journal of Applied Social Psychology, 1992, 22(14): 1111-1132. https://doi.org/10.1111/j.1559-1816.1992.tb00945.x doi: 10.1111/j.1559-1816.1992.tb00945.x
    [21] Ajzen, I., The theory of planned behaviour: Reactions and reflections. Psychology & Health, 2011, 26(9): 1113-1127. https://doi.org/10.1080/08870446.2011.613995 doi: 10.1080/08870446.2011.613995
    [22] Venkatesh, V. and Davis, F.D., A Theoretical Extension of the Technology Acceptance Model: Four Longitudinal Field Studies. Management Science, 2000, 46(2): 186-204. https://doi.org/10.1287/mnsc.46.2.186.11926 doi: 10.1287/mnsc.46.2.186.11926
    [23] Díaz, B. and Nussbaum, M., Artificial intelligence for teaching and learning in schools: the need for pedagogical intelligence. Computers & Education, 2024, 105071. https://doi.org/10.1016/j.compedu.2024.105071 doi: 10.1016/j.compedu.2024.105071
    [24] Rahm, L. and Rahm-Skågeby, J., Imaginaries and problematisations: A heuristic lens in the age of artificial intelligence in education, British Journal of Educational Technology, 2023, 54(5): 1147-1159. https://doi.org/10.1111/bjet.13319 doi: 10.1111/bjet.13319
    [25] Rogers, E.M., Diffusion of innovations (5th ed.), 2023, New York, Free Press.
    [26] Venkatesh, V., Determinants of perceived ease of use: Integrating control, intrinsic motivation, and emotion into the technology acceptance model. Information Systems Research, 2000, 11(4): 342-365. https://psycnet.apa.org/doi/10.1287/isre.11.4.342.11872
    [27] Venkatesh, V. and Bala, H., Technology acceptance model 3 and a research agenda on interventions. Decision Sciences, 2008, 39(2): 273-315. https://doi.org/10.1111/j.1540-5915.2008.00192.x doi: 10.1111/j.1540-5915.2008.00192.x
    [28] Zhang, C., Schießl, J., Plößl, L. and Hofmann, F., Acceptance of artificial intelligence among pre-service teachers: A multigroup analysis. International Journal of Educational Technology in Higher Education, 2023, 20(1): 49. https://doi.org/10.1186/s41239-023-00420-7 doi: 10.1186/s41239-023-00420-7
    [29] Ofosu-Ampong, K., Acheampong, B., Kevor, M. and Amankwah-Sarfo, F., Acceptance of artificial intelligence (ChatGPT) in education: trust, innovativeness and psychological need of students. Information and Knowledge Management, 2023, 13(4): 37-47. https://doi.org/10.7176/IKM/13-4-03 doi: 10.7176/IKM/13-4-03
    [30] Al-Emran, M., Mezhuyev, V. and Kamaludin, A., Technology acceptance model in m-learning context: A systematic review. Computers & Education, 2018,125: 389-412. https://doi.org/10.1016/j.compedu.2018.06.008 doi: 10.1016/j.compedu.2018.06.008
    [31] Al Darayseh, A., Acceptance of artificial intelligence in teaching science: Science teachers' perspective. Computers and Education: Artificial Intelligence, 2022, 4: 100132. https://doi.org/10.1016/j.caeai.2023.100132 doi: 10.1016/j.caeai.2023.100132
    [32] Esiyok, E., Gokcearslan, S. and Kucukergin, K.G., Acceptance of educational use of AI chatbots in the context of self-directed learning with technology and ICT self-efficacy of undergraduate students. International Journal of Human-Computer Interaction, 2024, 1-10. https://doi.org/10.1080/10447318.2024.2303557 doi: 10.1080/10447318.2024.2303557
    [33] Lee, D. and Lehto, M., User acceptance of YouTube for procedural learning: An extension of the technology acceptance model. Computers & Education, 2013, 61: 193-208. https://doi.org/10.1016/j.compedu.2012.10.001 doi: 10.1016/j.compedu.2012.10.001
    [34] Chow, M., Herold, D., Choo, T. and Chan, K., Extending the technology acceptance model to explore the intention to use second life for enhancing healthcare education. Computers & Education, 2012, 59(4): 1136-1144. https://doi.org/10.1016/j.compedu.2012.05.011 doi: 10.1016/j.compedu.2012.05.011
    [35] Saqr, R.R., Abdullah, S. and Sarhan, M.Y., Exploring the Acceptance and User Satisfaction of AI-Driven e-Learning Platforms (Blackboard, Moodle, Edmodo, Coursera and edX): An Integrated Technology Model. Sustainability, 2023, 16(1): 204. https://doi.org/10.3390/su16010204 doi: 10.3390/su16010204
    [36] Chang, C., Hajiyev, J. and Su, C., Examining the students' behavioral intention to use e-learning in Azerbaijan? The general extended technology acceptance model for e-learning approach. Computers & Education, 2017,111: 128-143. https://doi.org/10.1016/j.compedu.2017.04.010 doi: 10.1016/j.compedu.2017.04.010
    [37] Nja, C.O., Idiege, K.J., Uwe, U.E., Meremikwu, A.N., Ekon, E.E., Erim, C.M., et al., Adoption of artificial intelligence in science teaching: From the vantage point of the African science teachers. Smart Learning Environments, 2023, 10(1): 42. https://doi.org/10.1186/s40561-023-00261-x doi: 10.1186/s40561-023-00261-x
    [38] Wu, W., Zhang, B., Li, S. and Liu, H., Exploring factors of the willingness to accept AI-assisted learning environments: an empirical investigation based on the UTAUT model and perceived risk theory. Frontiers in Psychology, 2022, 13: 870777. https://doi.org/10.3389/fpsyg.2022.870777 doi: 10.3389/fpsyg.2022.870777
    [39] Jhantasana, C., Intrinsic and extrinsic motivation for university staff satisfaction: confirmatory composite analysis and confirmatory factor analysis. Asia Social Issues, 2022, 15(2): 249810. https://doi.org/10.48048/asi.2022.249810 doi: 10.48048/asi.2022.249810
    [40] Ajzen, I. and Fishbein, M., Understanding attitudes and predicting social behavior, 1980, Prentice Hall, Englewood Cliffs.
    [41] Soper, D., Calculator: a-priori sample size for structural equation models. Free Statistics Calculators, 2024. https://www.danielsoper.com/statcalc/calculator.aspx?id = 89
    [42] Hair, J.F., Hult, G.T.M., Ringle, C.M. and Sarstedt, M., A primer on partial least squares equation modeling (PLS-SEM), 2017, SAGE Publications, Inc., Los Angeles.
    [43] Kim, S. and Lee, Y., Investigation into the influence of socio-cultural factors on attitudes toward artificial intelligence. Education and Information Technologies, 2024, 29(8): 9907-9935. https://doi.org/10.1007/s10639-023-12172-y doi: 10.1007/s10639-023-12172-y
    [44] Wu, R. and Yu, Z., Do AI chatbots improve students' learning outcomes? Evidence from a meta-analysis. British Journal of Educational Technology, 2024, 55(1): 10-33. https://doi.org/10.1111/bjet.13334 doi: 10.1111/bjet.13334
    [45] Chin, C., Wong, W., Cham, T., Thong, J.Z. and Ling, J., Exploring the usage intention of AI-powered devices in smart homes among millennials and millennials: the moderating role of trust. Young Consumers, 2024, 25(1): 1-27. https://doi.org/10.1108/YC-05-2023-1752 doi: 10.1108/YC-05-2023-1752
    [46] Stein, JP., Messingschlager, T. and Gnambs, T., Attitudes towards AI: measurement and associations with personality. Scientific Reports, 2024, 14(1): 2909. https://doi.org/10.1038/s41598-024-53335-2 doi: 10.1038/s41598-024-53335-2
    [47] Kaya, F., Aydin, F., Schepman, A., Rodway, P., Yetişensoy, O. and Kaya, M., The roles of personality traits, AI anxiety, and demographic factors in attitudes toward Artificial Intelligence. International Journal of Human-Computer Interaction, 2024, 40(2): 497-514. https://doi.org/10.1080/10447318.2022.2151730 doi: 10.1080/10447318.2022.2151730
    [48] Ismaila, T.S., Musa, A.A. and Adebayo, E.T., Investigating pre-service teachers' artificial intelligence perception from the perspective of planned behavior theory. Computers and Education: Artificial Intelligence, 2024, 6: 100202. https://doi.org/10.1016/j.caeai.2024.100202 doi: 10.1016/j.caeai.2024.100202
    [49] Pokrivcakova, S., Pre-service teachers' attitudes towards artificial intelligence and its integration into EFL teaching and learning. Sciendo, 2024, 11(3): 100-114. https://doi.org/10.2478/jolace-2023-0031 doi: 10.2478/jolace-2023-0031
  • This article has been cited by:

    1. Christopher D. Carlucci, Yvonne Hui, Alena P. Chumanevich, Piper A. Robida, John W. Fuseler, Mathew Sajish, Prakash Nagarkatti, Mitzi Nagarkatti, Carole A. Oskeritzian, Resveratrol Protects against Skin Inflammation through Inhibition of Mast Cell, Sphingosine Kinase-1, Stat3 and NF-κB p65 Signaling Activation in Mice, 2023, 24, 1422-0067, 6707, 10.3390/ijms24076707
  • Author's biography Prof. Isidro Max V. Alejandro is an Associate Professor of Professional Education, Online Administrator at the College of Teacher Education, and the previous Technical/Vocational Certification Director at Cebu Normal University, Philippines. He specializes in educational technology, biology education, and educational leadership. His research interests include technology in education, teaching-learning in science, and technology management. He is a member of the Biology Teachers Association (BIOTA), the Philippine Association for Teachers and Educators (PAFTE), and the State Universities and Colleges Teacher Educators Association (SUCTEA); Dr. Joje Mar P. Sanchez is a Professor of Science Education, the Doctorate Program Chair at the College of Teacher Education, and the former Institute for Research in Innovative Instructional Delivery Director at Cebu Normal University, Philippines. He specializes in technology and innovative strategies in science. His research interests include chemistry and physics, environmental education, advanced mixed methods, educational data mining, and science investigatory project instruction. He is a member of the National Research Council of the Philippines (NRCP), Philippine Association of Chemistry Teachers (PACT), Samahang Pisika ng Pilipinas (SPP), PAFTE, and SUCTEA; Dr. Gino G. Sumalinog is a Professor of English Language Teaching and Research Chair at the College of Teacher Education at Cebu Normal University. He specializes in technology in education and English language teaching. His research interests include English and mother tongue-based instruction studies. He is a member of the Philippine Association for Language Teaching (PALT), NRCP, PAFTE, and SUCTEA; Dr. Janet A. Mananay is an Associate Professor of English Language Teaching at the College of Teacher Education and Internationalization Director at Cebu Normal University. She specializes in technology in education and English language teaching. Her research interests include English and mother tongue-based instruction, internationalization, and global citizenship. She is a member of PAFTE and SUCTEA; Dr. Charess E. Goles is an Associate Professor of Technology and Livelihood Education and Internationalization Chair at the College of Teacher Education. She specializes in technology in education and TLE. Her research interests include food systems, especially on Cebuano local resources like seaweeds. She is a Philippine Home Economics Association (PHEA), PAFTE, and SUCTEA member; Dr. Chery B. Fernandez is an Associate Professor of Guidance and Counseling and the Guidance Counselor at the College of Teacher Education. She specializes in guidance and counseling and values education. Her research interests include counseling, peer facilitation, and group dynamics. She is a member of the Philippine Guidance and Counseling Association (PGCA), PAFTE, and SUCTEA
    Reader Comments
  • © 2024 the Author(s), licensee AIMS Press. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0)
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Metrics

Article views(2973) PDF downloads(234) Cited by(1)

Figures and Tables

Figures(4)  /  Tables(9)

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return

Catalog